pLXRN-EGFP
(Plasmid
#99207)
-
PurposeEGFP expressing bicistronic retroviral vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLXSN
-
Backbone manufacturerDr. Dusty Miller, Fred Hutchinson Cancer Center, Seattle, WA
-
Modifications to backboneThe SV40 promoter driving Neomycin selection marker was replaced with an internal ribosome entry site/sequence (IRES) from encephalomyocarditis virus to generate the bicistronic retroviral vector
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsCan be propagated in E. coli DH5alpha. E. coli SURE or E. coli STBL recommended for minimizing recombination events
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt nameEnhanced green fluorescent protein
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)715
-
MutationA Kozak sequence was incorporated to enhance translational efficiency
-
GenBank IDU55762
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEGFP was PCR amplified off plasmid vector EGFP-N1 (GenBank acc. no. U55762)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When transfected into packaging cell lines PE501 (ecotropic) or PA317 (amphotropic) the plasmid will generate live retrovirus. Thus, under these conditions BSL2 safety will need to be observed.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXRN-EGFP was a gift from Peter Pedersen (Addgene plasmid # 99207 ; http://n2t.net/addgene:99207 ; RRID:Addgene_99207)