pLXRN-EGFP
(Plasmid #99207)

• Purpose: EGFP expressing bicistronic retroviral vector
• Depositing Lab: Peter Pedersen
• Publication: pLXRN bicistronic retroviral vector (unpublished)

Backbone

• Vector backbone: pLXSN
• Backbone manufacturer: Dr. Dusty Miller, Fred Hutchinson Cancer Center, Seattle, WA
• Modifications to backbone: The SV40 promoter driving Neomycin selection marker was replaced with an internal ribosome entry site/sequence (IRES) from encephalomyocarditis virus to generate the bicistronic retroviral vector
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can be propagated in E. coli DH5alpha. E. coli SURE or E. coli STBL recommended for minimizing recombination events
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Alt name: Enhanced green fluorescent protein
• Species: Synthetic; Aequorea victoria
• Insert Size (bp): 715
• Mutation: A Kozak sequence was incorporated to enhance translational efficiency
• GenBank ID: U55762
• Promoter: LTR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: EGFP was PCR amplified off plasmid vector EGFP-N1 (GenBank acc. no. U55762)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When transfected into packaging cell lines PE501 (ecotropic) or PA317 (amphotropic) the plasmid will generate live retrovirus. Thus, under these conditions BSL2 safety will need to be observed.