Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS2+ H2B-TagRFP-T
(Plasmid #99271)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99271 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagRFP-T
  • Insert Size (bp)
    732
  • Promoter SP6
  • Tag / Fusion Protein
    • H2B (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site Xbal (not destroyed)
  • 5′ sequencing primer CGATTTAGGTGACACTATAG
  • 3′ sequencing primer TAATACGACTCACTATAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: There is an N122D mutation in TagRFP in this plasmid. The depositor has confirmed this will not affect the plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+ H2B-TagRFP-T was a gift from Philipp Keller (Addgene plasmid # 99271 ; http://n2t.net/addgene:99271 ; RRID:Addgene_99271)