AAV pCAG-FLEX-mRuby3-WPRE
(Plasmid #99279)

• Purpose: Can be used to generate AAV virus that will express mRuby3 in the presence of Cre
• Depositing Lab: Rylan Larsen
• Publication: AAV red fluorescent protein plasmids (unpublished)

Backbone

• Vector backbone: AAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503)
• Backbone manufacturer: Hongkui Zeng/Allen Institute For Brain Science
• Backbone size w/o insert (bp): 5723
• Total vector size (bp): 6455
• Modifications to backbone: A fragment containing reverse-complemented mRuby3 was swapped into replace tdTomato. Total AAV packaging size (including ITRs and DNA in between) is 3858 bp.
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mRuby3
• Alt name: monomeric ruby3
• Alt name: mRuby3 red fluorescent protein
• Species: Synthetic
• Insert Size (bp): 733

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: FseI (not destroyed)
• 5′ sequencing primer: gcaacgtgctggttattgtg
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • AAV_pCAG_Flex_mRuby3_.gb
• A portion of this plasmid was derived from a plasmid made by: mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The stop codon for mRuby3 ends 24 bp downstream of the gene, adding an additional 8 amino acids to the protein. However, this is not expected to impact the function of the protein.