Skip to main content

AAV pCAG-FLEX-mScarlet-WPRE
(Plasmid #99280)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99280 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503)
  • Backbone manufacturer
    Hongkui Zeng/Allen Institute For Brain Science
  • Backbone size w/o insert (bp) 5719
  • Total vector size (bp) 6440
  • Modifications to backbone
    A fragment containing reverse-complemented mScarlet was swapped into replace tdTomato. Total AAV packaging size (including ITRs and DNA in between) is 3843 bp.
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mScarlet
  • Alt name
    monomeric Scarlet
  • Alt name
    mScarlet red fluorescent protein
  • Species
    Synthetic
  • Insert Size (bp)
    696

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer gcaacgtgctggttattgtg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mScarlet was synthesized de novo based on sequences published by Theodorus W J Gadella Jr's laboratory (Bindels et al, 2017, Nature Methods, PMID:27869816)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The stop codon for mRuby3 ends 24 bp downstream of the gene, adding an additional 8 amino acids to the protein. However, this is not expected to impact the function of the protein.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV pCAG-FLEX-mScarlet-WPRE was a gift from Rylan Larsen (Addgene plasmid # 99280 ; http://n2t.net/addgene:99280 ; RRID:Addgene_99280)