-
PurposeCan be used to generate AAV virus that will express mScarlet in the presence of Cre
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 99280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV pCAG-FLEX-tdTomato-WPRE (Addgene #51503)
-
Backbone manufacturerHongkui Zeng/Allen Institute For Brain Science
- Backbone size w/o insert (bp) 5719
- Total vector size (bp) 6440
-
Modifications to backboneA fragment containing reverse-complemented mScarlet was swapped into replace tdTomato. Total AAV packaging size (including ITRs and DNA in between) is 3843 bp.
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemScarlet
-
Alt namemonomeric Scarlet
-
Alt namemScarlet red fluorescent protein
-
SpeciesSynthetic
-
Insert Size (bp)696
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer gcaacgtgctggttattgtg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymScarlet was synthesized de novo based on sequences published by Theodorus W J Gadella Jr's laboratory (Bindels et al, 2017, Nature Methods, PMID:27869816)
-
Terms and Licenses
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV pCAG-FLEX-mScarlet-WPRE was a gift from Rylan Larsen (Addgene plasmid # 99280 ; http://n2t.net/addgene:99280 ; RRID:Addgene_99280)