Skip to main content
Addgene

pCAG-OSF-BECN1
(Plasmid #99328)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99328 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Beclin 1
  • Alt name
    BECN1
  • Species
    H. sapiens (human)
  • GenBank ID
    NP_003757.1
  • Entrez Gene
    BECN1 (a.k.a. ATG6, VPS30, beclin1)
  • Promoter CMV
  • Tag / Fusion Protein
    • Strep-Strep-Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer pCAG_fwd: 5�- TTC CTCGATCGACGGTATCGA
  • 3′ sequencing primer pCAG_rev: 5�- gagccagggcattggccacac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Strep-Strep-Flag-Beclin 1-stop, codon-optimized gene

IMPORT NOTES: Special character found in field(3-prime Sequencing Primer)

IMPORT NOTES: Special character found in field(5-prime Sequencing Primer)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-OSF-BECN1 was a gift from James Hurley (Addgene plasmid # 99328 ; http://n2t.net/addgene:99328 ; RRID:Addgene_99328)
  • For your References section:

    Architecture and dynamics of the autophagic phosphatidylinositol 3-kinase complex. Baskaran S, Carlson LA, Stjepanovic G, Young LN, Kim DJ, Grob P, Stanley RE, Nogales E, Hurley JH. Elife. 2014 Dec 9;3. doi: 10.7554/eLife.05115. 10.7554/eLife.05115 PubMed 25490155