Skip to main content
Addgene

pFastBac-ATG101-ATG13 HORMA
(Plasmid #99332)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99332 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac-Dual
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ATG101
  • Species
    H. sapiens (human)
  • GenBank ID
    NP_068753.2
  • Entrez Gene
    ATG101 (a.k.a. C12orf44)
  • Promoter p10

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer p10_Fwd: 5'- TACGGACCTTTAATTCAACCC -3'
  • 3′ sequencing primer p10_rev: 5'- TTCCGGTATTGTCTCCTTCCGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ATG13
  • Species
    H. sapiens (human)
  • GenBank ID
    NP_001136145.1
  • Entrez Gene
    ATG13 (a.k.a. KIAA0652, PARATARG8)
  • Promoter pH
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer pH_Fwd:5'- TCCGGATTATTCATACCGTC -3'
  • 3′ sequencing primer pH_rev:5'- TGTGGTATGGCTGATTATGATC -3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains a dual insertion: ATG101 in p10 cassette; GST-TEVsite-ATG13 (12-200) in pH cassette.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac-ATG101-ATG13 HORMA was a gift from James Hurley (Addgene plasmid # 99332 ; http://n2t.net/addgene:99332 ; RRID:Addgene_99332)
  • For your References section:

    Structure of the Human Atg13-Atg101 HORMA Heterodimer: an Interaction Hub within the ULK1 Complex. Qi S, Kim DJ, Stjepanovic G, Hurley JH. Structure. 2015 Oct 6;23(10):1848-57. doi: 10.1016/j.str.2015.07.011. Epub 2015 Aug 20. 10.1016/j.str.2015.07.011 PubMed 26299944