pFastBac-ATG101-ATG13 HORMA
(Plasmid
#99332)
-
PurposeMammalian expression of one subcomplex from the Human ULK1 complex
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFastBac-Dual
-
Backbone manufacturerInvitrogen
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameATG101
-
SpeciesH. sapiens (human)
-
GenBank IDNP_068753.2
-
Entrez GeneATG101 (a.k.a. C12orf44)
- Promoter p10
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer p10_Fwd: 5'- TACGGACCTTTAATTCAACCC -3'
- 3′ sequencing primer p10_rev: 5'- TTCCGGTATTGTCTCCTTCCGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameATG13
-
SpeciesH. sapiens (human)
-
GenBank IDNP_001136145.1
-
Entrez GeneATG13 (a.k.a. KIAA0652, PARATARG8)
- Promoter pH
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer pH_Fwd:5'- TCCGGATTATTCATACCGTC -3'
- 3′ sequencing primer pH_rev:5'- TGTGGTATGGCTGATTATGATC -3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains a dual insertion: ATG101 in p10 cassette; GST-TEVsite-ATG13 (12-200) in pH cassette.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac-ATG101-ATG13 HORMA was a gift from James Hurley (Addgene plasmid # 99332 ; http://n2t.net/addgene:99332 ; RRID:Addgene_99332) -
For your References section:
Structure of the Human Atg13-Atg101 HORMA Heterodimer: an Interaction Hub within the ULK1 Complex. Qi S, Kim DJ, Stjepanovic G, Hurley JH. Structure. 2015 Oct 6;23(10):1848-57. doi: 10.1016/j.str.2015.07.011. Epub 2015 Aug 20. 10.1016/j.str.2015.07.011 PubMed 26299944