IMPT-6213
              
              
                (Plasmid
                
                #99333)
              
            
            
            
          - 
            PurposeAT2R N terminal BRIL, linker GSGS, delta aa 1-34, delta aa 336-363
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepFastBac1
- 
              Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 4775
- Total vector size (bp) 6036
- 
              Vector typeInsect Expression
- 
                Selectable markersGentamicin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameAGTR2
- 
                  Alt nameType-2 angiotensin II receptor
- 
                  Alt nameAngiotensin II type-2 receptor
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)1359
- 
                    GenBank IDAAA50762.1
- 
                        Entrez GeneAGTR2 (a.k.a. AT2, ATGR2, MRX88)
- Promoter polyhedrin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TATTCCGGATTATTCATACC
- 3′ sequencing primer ACAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: IMPT-6213 was a gift from Raymond Stevens (Addgene plasmid # 99333 ; http://n2t.net/addgene:99333 ; RRID:Addgene_99333)
- 
                For your References section: Structural basis for selectivity and diversity in angiotensin II receptors. Zhang H, Han GW, Batyuk A, Ishchenko A, White KL, Patel N, Sadybekov A, Zamlynny B, Rudd MT, Hollenstein K, Tolstikova A, White TA, Hunter MS, Weierstall U, Liu W, Babaoglu K, Moore EL, Katz RD, Shipman JM, Garcia-Calvo M, Sharma S, Sheth P, Soisson SM, Stevens RC, Katritch V, Cherezov V. Nature. 2017 Apr 20;544(7650):327-332. doi: 10.1038/nature22035. Epub 2017 Apr 5. 10.1038/nature22035 PubMed 28379944
