Skip to main content

IMPT-6213
(Plasmid #99333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99333 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 4775
  • Total vector size (bp) 6036
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AGTR2
  • Alt name
    Type-2 angiotensin II receptor
  • Alt name
    Angiotensin II type-2 receptor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1359
  • GenBank ID
    AAA50762.1
  • Entrez Gene
    AGTR2 (a.k.a. AT2, ATGR2, MRX88)
  • Promoter polyhedrin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TATTCCGGATTATTCATACC
  • 3′ sequencing primer ACAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    IMPT-6213 was a gift from Raymond Stevens (Addgene plasmid # 99333 ; http://n2t.net/addgene:99333 ; RRID:Addgene_99333)
  • For your References section:

    Structural basis for selectivity and diversity in angiotensin II receptors. Zhang H, Han GW, Batyuk A, Ishchenko A, White KL, Patel N, Sadybekov A, Zamlynny B, Rudd MT, Hollenstein K, Tolstikova A, White TA, Hunter MS, Weierstall U, Liu W, Babaoglu K, Moore EL, Katz RD, Shipman JM, Garcia-Calvo M, Sharma S, Sheth P, Soisson SM, Stevens RC, Katritch V, Cherezov V. Nature. 2017 Apr 20;544(7650):327-332. doi: 10.1038/nature22035. Epub 2017 Apr 5. 10.1038/nature22035 PubMed 28379944