Skip to main content

pUC19-Cv3
(Plasmid #99351)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99351 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 2692
  • Total vector size (bp) 3779
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Line from The Crucible Act 3
  • Alt name
    Cv3
  • Insert Size (bp)
    1087

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer GTGCTGCAAGGCGATTAAGTTGG
  • 3′ sequencing primer CGCAATTAATGTGAGTTAGCTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-Cv3 was a gift from Mark Bathe (Addgene plasmid # 99351 ; http://n2t.net/addgene:99351 ; RRID:Addgene_99351)
  • For your References section:

    In vitro synthesis of gene-length single-stranded DNA. Veneziano R, Shepherd TR, Ratanalert S, Bellou L, Tao C, Bathe M. Sci Rep. 2018 Apr 25;8(1):6548. doi: 10.1038/s41598-018-24677-5. 10.1038/s41598-018-24677-5 PubMed 29695837