Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TMEM230-WT-IRES(isoform 1)
(Plasmid #99558)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99558 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    plRES2-ZsGreen1 Vector (632478)
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TMEM230
  • Alt name
    NM_001009923
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    558
  • Entrez Gene
    TMEM230 (a.k.a. C20orf30, HSPC274, dJ1116H23.2.1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer ctaggaatgctcgtcaagaagaca
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TMEM230-WT-IRES(isoform 1) was a gift from Han-Xiang Deng (Addgene plasmid # 99558 ; http://n2t.net/addgene:99558 ; RRID:Addgene_99558)
  • For your References section:

    Identification of TMEM230 mutations in familial Parkinson's disease. Deng HX, Shi Y, Yang Y, Ahmeti KB, Miller N, Huang C, Cheng L, Zhai H, Deng S, Nuytemans K, Corbett NJ, Kim MJ, Deng H, Tang B, Yang Z, Xu Y, Chan P, Huang B, Gao XP, Song Z, Liu Z, Fecto F, Siddique N, Foroud T, Jankovic J, Ghetti B, Nicholson DA, Krainc D, Melen O, Vance JM, Pericak-Vance MA, Ma YC, Rajput AH, Siddique T. Nat Genet. 2016 Jul;48(7):733-9. doi: 10.1038/ng.3589. Epub 2016 Jun 6. 10.1038/ng.3589 PubMed 27270108