TMEM230-M4/X184PG-IRES(isoform 2)
(Plasmid
#99568)
-
Purposemammalian expression of mutant TMEM230 (isoform 2) and ZsGreen
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneplRES2-ZsGreen1 Vector (632478)
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTMEM230
-
Alt nameNM_001009924
-
SpeciesH. sapiens (human)
-
Insert Size (bp)368
-
MutationM4/X184PG
-
Entrez GeneTMEM230 (a.k.a. C20orf30, HSPC274, dJ1116H23.2.1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer ctaggaatgctcgtcaagaagaca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TMEM230-M4/X184PG-IRES(isoform 2) was a gift from Han-Xiang Deng (Addgene plasmid # 99568 ; http://n2t.net/addgene:99568 ; RRID:Addgene_99568) -
For your References section:
Identification of TMEM230 mutations in familial Parkinson's disease. Deng HX, Shi Y, Yang Y, Ahmeti KB, Miller N, Huang C, Cheng L, Zhai H, Deng S, Nuytemans K, Corbett NJ, Kim MJ, Deng H, Tang B, Yang Z, Xu Y, Chan P, Huang B, Gao XP, Song Z, Liu Z, Fecto F, Siddique N, Foroud T, Jankovic J, Ghetti B, Nicholson DA, Krainc D, Melen O, Vance JM, Pericak-Vance MA, Ma YC, Rajput AH, Siddique T. Nat Genet. 2016 Jul;48(7):733-9. doi: 10.1038/ng.3589. Epub 2016 Jun 6. 10.1038/ng.3589 PubMed 27270108