Skip to main content

pFUS_A8
(Plasmid #99882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99882 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUS_A
  • Vector type
    TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ttgatgcctggcagttccct
  • 3′ sequencing primer cgaaccgaacaggcttatgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The BsaI cuting sites were modified to receive 8 TALE repeats for Golden Gate Assembly

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUS_A8 was a gift from Yiping Qi (Addgene plasmid # 99882 ; http://n2t.net/addgene:99882 ; RRID:Addgene_99882)
  • For your References section:

    Robust transcriptional activation in plants using multiplexed CRISPR-Act2.0 and mTALE-Act systems. Lowder LG, Zhou J, Zhang Y, Malzahn A, Zhong Z, Hsieh TF, Voytas DF, Zhang Y, Qi Y. Mol Plant. 2017 Nov 29. pii: S1674-2052(17)30344-1. doi: 10.1016/j.molp.2017.11.010. 10.1016/j.molp.2017.11.010 PubMed 29197638