Skip to main content

pHR-TRE3G-NLS-tdPCP-EGFP
(Plasmid #99910)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99910 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-tdPCP-EGFP
  • Species
    Synthetic
  • Promoter TRE4G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer gtgtacggtgggaggcctatataa
  • 3′ sequencing primer caaaggcattaaagcagcgtatccac
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-TRE3G-NLS-tdPCP-EGFP was a gift from Yujie Sun (Addgene plasmid # 99910 ; http://n2t.net/addgene:99910 ; RRID:Addgene_99910)
  • For your References section:

    Long-term dual-color tracking of genomic loci by modified sgRNAs of the CRISPR/Cas9 system. Shao S, Zhang W, Hu H, Xue B, Qin J, Sun C, Sun Y, Wei W, Sun Y. Nucleic Acids Res. 2016 May 19;44(9):e86. doi: 10.1093/nar/gkw066. Epub 2016 Feb 4. 10.1093/nar/gkw066 PubMed 26850639