Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Physiological and pathophysiological control of synaptic GluN2B-NMDA receptors by the C-terminal domain of amyloid precursor protein.
Pousinha PA, Mouska X, Raymond EF, Gwizdek C, Dhib G, Poupon G, Zaragosi LE, Giudici C, Bethus I, Pacary E, Willem M, Marie H
Elife. 2017 Jul 6;6. doi: 10.7554/eLife.25659.
PubMed Article

Plasmids from Article

ID Plasmid Purpose  
107543pAAV-AICD-NLS-IRES-hrGFPAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP
Loading...
107544pAAV-AICD-NES-IRES-hrGFPAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFP
Loading...
107546pAAV-APLP1ICD-IRES-hrGFPAAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cells
Loading...
107548pAAV-syn-AICD-IRES-hrGFPhigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFP
Loading...
107549pAAV-syn-IRES-hrGFPhigh transduction efficiency AAV-mediated synapsin promoter-dependent expression IRES-hrGFP
Loading...