Differentially Optimized Cell-Free Buffer Enables Robust Expression from Unprotected Linear DNA in Exonuclease-Deficient Extracts.
Batista AC, Levrier A, Soudier P, Voyvodic PL, Achmedov T, Reif-Trauttmansdorff T, DeVisch A, Cohen-Gonsaud M, Faulon JL, Beisel CL, Bonnet J, Kushwaha M
ACS Synth Biol. 2022 Jan 16. doi: 10.1021/acssynbio.1c00448.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 177369 | sTR056 | Toehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch. |
| 177370 | sTR060 | Trigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity. |