Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
MASTL promotes cell contractility and motility through kinase-independent signaling.
Taskinen ME, Narva E, Conway JRW, Hinojosa LS, Lilla S, Mai A, De Franceschi N, Elo LL, Grosse R, Zanivan S, Norman JC, Ivaska J
J Cell Biol. 2020 Jun 1;219(6). pii: 151688. doi: 10.1083/jcb.201906204. PubMed Article

Plasmids from Article

ID Plasmid Purpose
191011pcDNA-EGFP MASTL WT (siRNA resistant)Expresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)
191012pcDNA-EGFP MASTL G44S (siRNA resistant)Expresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)
191013pcDNA-EGFP MASTL E167D (siRNA resistant)Expresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)

Antibodies from Article