Skip to main content
Addgene

Serotonin acts through multiple cellular targets during an olfactory critical period.

Mallick A, Tan HL, Epstein JM, Gaudry Q, Dacks AM
bioRxiv [Preprint]. 2024 Apr 14:2024.04.14.589413. doi: 10.1101/2024.04.14.589413. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
221818pTwist Amp_d5-HT7R-7xsfGFP11-HA-HDR-donorDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT7R coding frame
221819pTwist Amp_d5-HT7R-sfGFP11-HA-CRISPR-HDR-donorDonor plasmid for inserting GFP11-HA to the end of Drosophila 5-HT7R coding frame
221820pdU6-2_sgRNA-d5-HT1ARPlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frame
221821pdU6-2_sgRNA1-d5-HT1BRPlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frame
221822pdU6-2_sgRNA2-5-HT1BRPlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frame
221823pdU6-2_sgRNA1-5-HT2AR-isoformDPlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frame
221824pdU6-2_sgRNA2-5-HT2AR-isoformDPlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frame
221825pdU6-2_sgRNA1-5-HT2AR-isoformBFHPlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame
221826pdU6-2_sgRNA2-5-HT2AR-isoformBFHPlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame
221827pdU6-2_sgRNA1-d5-HT2BRPlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frame
221828pdU6-2_sgRNA2-d5-HT2BRPlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frame
221829pdU6-2_sgRNA-d5-HT7RPlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frame
221830pdU6-2_sgRNA1-for-dSERTPlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frame
221831pdU6-2_sgRNA2-for-dSERTPlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frame
221832pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donorDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frame
221833pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donorDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frame
22183413xLexAop2 IVS sfGFP1-10Plasmid for generating 13xLexAop2 IVS sfGFP1-10 with attP/attB integration. It carries the attB sequence.
221835pTwist Amp_2xFlag-dSERT-HDR-donor-HDRDonor plasmid for inserting 2xFLAG at the beginning of Drosophila SERT coding frame
221836pACUH 5-HT7R-7xGFP11-HAPlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.
221837pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donorDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frame
221838pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donorDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frame
221839pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donorDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame
221840pACUH 5-HT2BR-7xGFP11-HAPlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.

Antibodies from Article