Serotonin acts through multiple cellular targets during an olfactory critical period.
Mallick A, Tan HL, Epstein JM, Gaudry Q, Dacks AM
bioRxiv [Preprint]. 2024 Apr 14:2024.04.14.589413. doi: 10.1101/2024.04.14.589413.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
221818 | pTwist Amp_d5-HT7R-7xsfGFP11-HA-HDR-donor | Donor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT7R coding frame |
221819 | pTwist Amp_d5-HT7R-sfGFP11-HA-CRISPR-HDR-donor | Donor plasmid for inserting GFP11-HA to the end of Drosophila 5-HT7R coding frame |
221820 | pdU6-2_sgRNA-d5-HT1AR | Plasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frame |
221821 | pdU6-2_sgRNA1-d5-HT1BR | Plasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frame |
221822 | pdU6-2_sgRNA2-5-HT1BR | Plasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frame |
221823 | pdU6-2_sgRNA1-5-HT2AR-isoformD | Plasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frame |
221824 | pdU6-2_sgRNA2-5-HT2AR-isoformD | Plasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frame |
221825 | pdU6-2_sgRNA1-5-HT2AR-isoformBFH | Plasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame |
221826 | pdU6-2_sgRNA2-5-HT2AR-isoformBFH | Plasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame |
221827 | pdU6-2_sgRNA1-d5-HT2BR | Plasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frame |
221828 | pdU6-2_sgRNA2-d5-HT2BR | Plasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frame |
221829 | pdU6-2_sgRNA-d5-HT7R | Plasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frame |
221830 | pdU6-2_sgRNA1-for-dSERT | Plasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frame |
221831 | pdU6-2_sgRNA2-for-dSERT | Plasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frame |
221832 | pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donor | Donor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frame |
221833 | pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donor | Donor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frame |
221834 | 13xLexAop2 IVS sfGFP1-10 | Plasmid for generating 13xLexAop2 IVS sfGFP1-10 with attP/attB integration. It carries the attB sequence. |
221835 | pTwist Amp_2xFlag-dSERT-HDR-donor-HDR | Donor plasmid for inserting 2xFLAG at the beginning of Drosophila SERT coding frame |
221836 | pACUH 5-HT7R-7xGFP11-HA | Plasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence. |
221837 | pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donor | Donor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frame |
221838 | pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor | Donor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frame |
221839 | pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor | Donor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frame |
221840 | pACUH 5-HT2BR-7xGFP11-HA | Plasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence. |