Jolanda Van Leeuwen Lab: van Leeuwen Lab plasmids 2025
Unpublished
Plasmids from Article
ID | Plasmid | Purpose |
---|---|---|
232881 | pML104-HIS3-2 | Plasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene. |
232882 | pML104-HIS3-3 | Plasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene. |
232883 | pML104-LEU2-2 | Plasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene. |
232884 | pML107-RER2 | Plasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene. |
232885 | pML104-HygMx4-URA3-2 | Plasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene. |
232886 | pML104-HygMx4-URA3-3 | Plasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene. |
232887 | pML107-ADE13 | Plasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene. |
232888 | pML107-ARB1 | Plasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene. |
232889 | pML107-AVO1 | Plasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene. |
232890 | pML107-INO80 | Plasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene. |
232891 | pML107-KAE1 | Plasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene. |
232892 | pML107-LAS17 | Plasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene. |
232893 | pML107-NET1 | Plasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene. |
232894 | pML104-LEU2-3 | Plasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene. |
232895 | pML107-SAM50 | Plasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene. |
232896 | pML107-SRP14 | Plasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene. |
232897 | pML107-TLG1 | Plasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene. |
232898 | pML107-VHT1 | Plasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene. |
232899 | pML107-VRG4 | Plasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene. |
232900 | pML107-YFR054C | Plasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene. |
232901 | pML107-ZIM17 | Plasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene. |
232902 | pRS313-rad53-5004 | Plasmid carrying the rad53-5004 allele with its native promoter and terminator. |
232903 | pRS313_MSN5-LY00018 | Plasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator. |
232904 | pRS313_MSN5-LY00045 | Plasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator. |