The modifiers that cause changes in gene essentiality.

Batte A, Bosch-Guiteras N, Pons C, Ota M, Lopes M, Sharma S, Tellini N, Paltenghi C, Conti M, Kan KT, Ho UL, Wiederkehr M, Barraud J, Ashe M, Aloy P, Liti G, Chabes A, Parts L, van Leeuwen J
Cell Syst. 2026 Mar 2:101515. doi: 10.1016/j.cels.2025.101515. PubMed Article

Plasmids from Article

ID	Plasmid	Purpose
232881	pML104-HIS3-2	Plasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.
232882	pML104-HIS3-3	Plasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.
232883	pML104-LEU2-2	Plasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.
232884	pML107-RER2	Plasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.
232885	pML104-HygMx4-URA3-2	Plasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.
232886	pML104-HygMx4-URA3-3	Plasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.
232887	pML107-ADE13	Plasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.
232888	pML107-ARB1	Plasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.
232889	pML107-AVO1	Plasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.
232890	pML107-INO80	Plasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.
232891	pML107-KAE1	Plasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.
232892	pML107-LAS17	Plasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.
232893	pML107-NET1	Plasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.
232894	pML104-LEU2-3	Plasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.
232895	pML107-SAM50	Plasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.
232896	pML107-SRP14	Plasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.
232897	pML107-TLG1	Plasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.
232898	pML107-VHT1	Plasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.
232899	pML107-VRG4	Plasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.
232900	pML107-YFR054C	Plasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.
232901	pML107-ZIM17	Plasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.
232902	pRS313-rad53-5004	Plasmid carrying the rad53-5004 allele with its native promoter and terminator.
232903	pRS313_MSN5-LY00018	Plasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.
232904	pRS313_MSN5-LY00045	Plasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.