Skip to main content
Addgene

Jolanda Van Leeuwen Lab: van Leeuwen Lab plasmids 2025

Unpublished

Plasmids from Article

ID Plasmid Purpose
232881pML104-HIS3-2Plasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.
232882pML104-HIS3-3Plasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.
232883pML104-LEU2-2Plasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.
232884pML107-RER2Plasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.
232885pML104-HygMx4-URA3-2Plasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.
232886pML104-HygMx4-URA3-3Plasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.
232887pML107-ADE13Plasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.
232888pML107-ARB1Plasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.
232889pML107-AVO1Plasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.
232890pML107-INO80Plasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.
232891pML107-KAE1Plasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.
232892pML107-LAS17Plasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.
232893pML107-NET1Plasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.
232894pML104-LEU2-3Plasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.
232895pML107-SAM50Plasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.
232896pML107-SRP14Plasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.
232897pML107-TLG1Plasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.
232898pML107-VHT1Plasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.
232899pML107-VRG4Plasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.
232900pML107-YFR054CPlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.
232901pML107-ZIM17Plasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.
232902pRS313-rad53-5004Plasmid carrying the rad53-5004 allele with its native promoter and terminator.
232903pRS313_MSN5-LY00018Plasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.
232904pRS313_MSN5-LY00045Plasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.

Antibodies from Article