Franz-Ulrich Hartl Lab: α-Synuclein aggregates inhibit ESCRT-III through sequestration and collateral degradation
Sitron CS, Trinkaus VA, Galesic A, Garhammer M, Checa PY, Dransfeld U, Feigenbutz D, Zhang J, Dudanova I, Harper JW, Hartl FU
Unpublished
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 215372 | pTetOFF SNCA-A53T | All-in-one lentiviral construct for the dox repressible expression of the A53T mutant of alpha-synuclein. |
| 215373 | pCMV-EGFP-RNF152-IRES-mScarlet-I | Bicistronic expression of EGFP-tagged lysosome membrane protein RNF152, along with mScarlet-I expressed as an expression control. |
| 215374 | phSyn2 sfGFP-RNF152 | Lentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter. |
| 215375 | pCMV mRuby3-Galectin-3 | Expression of the endolysosomal damage marker Galectin-3 with an N-terminal mRuby3 tag. |
| 215376 | pCMV mClover3-Galectin-3 | Expression of the endolysosomal damage marker Galectin-3 with an N-terminal mClover3 tag. |
| 215377 | pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR | Lentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control. |
| 215378 | pCMV-SNCA-A53T-mClover3 | Expression of the A53T mutant of alpha-synuclein with a C-terminal mClover3 tag. |
| 215379 | pCMV-SNCA-A53T-mRuby3 | Expression of the A53T mutant of alpha-synuclein with a C-terminal mRuby3 tag. |
| 231998 | pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc | Expression of an sgRNA targeting CHMP2B, Cas9, and a PuroR marker |
| 231999 | pCMV mTagBFP2 | Expression of mTagBFP2 |
| 232000 | pCMV mTagBFP2-2A-CHMP2B | Bicistronic expression of CHMP2B along with an mTagBFP2 transfection marker, connected via 2A sequences. |
| 232001 | pCMV mTagBFP2-2A-CHMP2B-Q165X | Bicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences. |
| 232002 | pCMV CHMP2B-3XHA | Expression of CHMP2B with a 3xHA tag. |
| 232003 | pCMV CHMP2B-L4D F5D-3XHA | Expression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag. |
| 232004 | pCMV CHMP2B-L4D F5D-d10-52-3xHA (Δα1) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the first alpha helix deleted with a 3xHA tag. |
| 232005 | pCMV CHMP2B-L4D F5D-d55-96-3xHA (Δα2) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the second alpha helix deleted with a 3xHA tag. |
| 232006 | pCMV CHMP2B-L4D F5D-d97-106-3xHA (Δα2/3 loop) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the loop connecting the second and third alpha helices deleted with a 3xHA tag. |
| 232007 | pCMV CHMP2B-L4D F5D-d106-113-3xHA (Δα3) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the third alpha helix deleted with a 3xHA tag. |
| 232008 | pCMV CHMP2B-L4D F5D-d118-138-3xHA (Δα4) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the fourth alpha helix deleted with a 3xHA tag. |
| 232009 | pCMV CHMP2B-L4D F5D-d55-138-3xHA (Δα2-4) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the second through fourth helices deleted with a 3xHA tag. |
| 232010 | pCMV CHMP2B-L4D F5D-d159-174-3xHA (Δα5) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the fifth alpha helix deleted with a 3xHA tag. |
| 232011 | pCMV CHMP2B-L4D F5D-d201-213-HA (ΔVPS4 binding) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the VPS4-binding region deleted with a 3xHA tag. |
| 232012 | pEF1a FLAG-CHMP2B | Expression of FLAG-tagged CHMP2B |
| 232013 | pEF1a FLAG-CHMP2B-d55-96 | Expression of FLAG-tagged CHMP2B with the second alpha helix deleted. |
| 232014 | pCMV sfGFP-CHMP2B-55-96 | Expression of CHMP2B helix 2 attached to sfGFP. |
| 232015 | pCMV sfGFP-CHMP2B-3x-55-96 | Expression of 3 tandem copies of CHMP2B helix 2, connected with gly-ser linkers, attached to sfGFP. |
| 232016 | pCMV sfGFP-CHMP2B-201-213 | Expression of the CHMP2B VPS4-binding region attached to sfGFP. |
| 232017 | pT7-7 a-syn A53T D115A mNeonGreen-3K-B11 | Bacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3K |
| 232018 | pET28 His-SUMO-CHMP2B | Bacterial expression of His and SUMO tagged CHMP2B |