alpha-Synuclein aggregates inhibit ESCRT-III through sequestration and collateral degradation.
Sitron CS, Trinkaus VA, Galesic A, Garhammer M, Yuste-Checa P, Dransfeld U, Feigenbutz D, Zhang J, Ivashko L, Dudanova I, Harper JW, Hartl FU
Mol Cell. 2025 Sep 18;85(18):3505-3523.e17. doi: 10.1016/j.molcel.2025.08.022. Epub 2025 Sep 10.
(Link opens in a new window)
PubMed
(Link opens in a new window)
Article
Plasmids from Article
| ID | Plasmid | Purpose |
|---|---|---|
| 215372 | pTetOFF SNCA-A53T | All-in-one lentiviral construct for the dox repressible expression of the A53T mutant of alpha-synuclein. |
| 215373 | pCMV-EGFP-RNF152-IRES-mScarlet-I | Bicistronic expression of EGFP-tagged lysosome membrane protein RNF152, along with mScarlet-I expressed as an expression control. |
| 215374 | phSyn2 sfGFP-RNF152 | Lentiviral expression of sfGFP-tagged lysosome membrane protein RNF152 under the neuron-specific human synapsin promoter. |
| 215375 | pCMV mRuby3-Galectin-3 | Expression of the endolysosomal damage marker Galectin-3 with an N-terminal mRuby3 tag. |
| 215376 | pCMV mClover3-Galectin-3 | Expression of the endolysosomal damage marker Galectin-3 with an N-terminal mClover3 tag. |
| 215377 | pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR | Lentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control. |
| 215378 | pCMV-SNCA-A53T-mClover3 | Expression of the A53T mutant of alpha-synuclein with a C-terminal mClover3 tag. |
| 215379 | pCMV-SNCA-A53T-mRuby3 | Expression of the A53T mutant of alpha-synuclein with a C-terminal mRuby3 tag. |
| 231998 | pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc | Expression of an sgRNA targeting CHMP2B, Cas9, and a PuroR marker |
| 231999 | pCMV mTagBFP2 | Expression of mTagBFP2 |
| 232000 | pCMV mTagBFP2-2A-CHMP2B | Bicistronic expression of CHMP2B along with an mTagBFP2 transfection marker, connected via 2A sequences. |
| 232001 | pCMV mTagBFP2-2A-CHMP2B-Q165X | Bicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences. |
| 232002 | pCMV CHMP2B-3XHA | Expression of CHMP2B with a 3xHA tag. |
| 232003 | pCMV CHMP2B-L4D F5D-3XHA | Expression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag. |
| 232004 | pCMV CHMP2B-L4D F5D-d10-52-3xHA (Δα1) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the first alpha helix deleted with a 3xHA tag. |
| 232005 | pCMV CHMP2B-L4D F5D-d55-96-3xHA (Δα2) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the second alpha helix deleted with a 3xHA tag. |
| 232006 | pCMV CHMP2B-L4D F5D-d97-106-3xHA (Δα2/3 loop) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the loop connecting the second and third alpha helices deleted with a 3xHA tag. |
| 232007 | pCMV CHMP2B-L4D F5D-d106-113-3xHA (Δα3) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the third alpha helix deleted with a 3xHA tag. |
| 232008 | pCMV CHMP2B-L4D F5D-d118-138-3xHA (Δα4) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the fourth alpha helix deleted with a 3xHA tag. |
| 232009 | pCMV CHMP2B-L4D F5D-d55-138-3xHA (Δα2-4) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the second through fourth helices deleted with a 3xHA tag. |
| 232010 | pCMV CHMP2B-L4D F5D-d159-174-3xHA (Δα5) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the fifth alpha helix deleted with a 3xHA tag. |
| 232011 | pCMV CHMP2B-L4D F5D-d201-213-HA (ΔVPS4 binding) | Expression of a CHMP2B membrane binding mutant (L4D F5D) with the VPS4-binding region deleted with a 3xHA tag. |
| 232012 | pEF1a FLAG-CHMP2B | Expression of FLAG-tagged CHMP2B |
| 232013 | pEF1a FLAG-CHMP2B-d55-96 | Expression of FLAG-tagged CHMP2B with the second alpha helix deleted. |
| 232014 | pCMV sfGFP-CHMP2B-55-96 | Expression of CHMP2B helix 2 attached to sfGFP. |
| 232015 | pCMV sfGFP-CHMP2B-3x-55-96 | Expression of 3 tandem copies of CHMP2B helix 2, connected with gly-ser linkers, attached to sfGFP. |
| 232016 | pCMV sfGFP-CHMP2B-201-213 | Expression of the CHMP2B VPS4-binding region attached to sfGFP. |
| 232017 | pT7-7 a-syn A53T D115A mNeonGreen-3K-B11 | Bacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3K |
| 232018 | pET28 His-SUMO-CHMP2B | Bacterial expression of His and SUMO tagged CHMP2B |
| 242393 | pCMV CHMP2B-L4D,F5D-V82E-3XHA | Expression of a CHMP2B membrane binding mutant (L4D F5D) with a V82E mutation and a 3xHA tag. |
| 242416 | pCMV CHMP2B-L4D,F5D-M85E-3XHA | Expression of a CHMP2B membrane binding mutant (L4D F5D) with a M85E mutation and a 3xHA tag. |
| 242417 | pCMV CHMP2B-L4D,F5D-M92E-3XHA | Expression of a CHMP2B membrane binding mutant (L4D F5D) with a M92E mutation and a 3xHA tag. |
| 242418 | pCMV CHMP2B-L4D,F5D-V82E M85E M92E-3XHA | Expression of a CHMP2B membrane binding mutant (L4D F5D) with V82E, M85E, and M92E mutations and a 3xHA tag. |
| 242420 | pCMV sfGFP-CHMP6 57-98 | Expression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFP |
| 242421 | pLKO.1 mouse NT | Expression of a non-targeting shRNA in mouse cells |
| 242422 | pLKO.1 mouse Chmp2b | Expression of a Chmp2b-targeting shRNA in mouse cells |