Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
187612 pLV-EF1A-WWE(R163A)-HA-nLuc-FLAG-T2A-WWE-myc-cLuc-FLAG-IRES-Puro WWE domain (R163A) with C-terminal nLuc (Homo sapiens), WWE domain with C-terminal cLuc (Homo sapiens) Sobol Sep 14, 2022
187287 IL2-AH-2A-Cherry-RhoAQ63L in pmCherryN1 interleukin-2 receptor alpha-subunit, anillin, RhoA (Homo sapiens) Yap Sep 14, 2022
187288 IL2-AHA740D, E758K-2A-Cherry-RhoAQ63L in pmCherryN1 interleukin-2 receptor alpha-subunit, anillin, RhoA (Homo sapiens) Yap Sep 14, 2022
187609 pLV-EF1A-LivePAR(R163A)-Hygro LivePAR(R163A) (Homo sapiens) Sobol Sep 14, 2022
182921 EGFP-Ki-67(RASA)-mCherry_IRESpuro2 MKI67 (Homo sapiens) Gerlich Sep 14, 2022
183744 Ki67 (shuffled Nterm)-mNeonGreen-IRESpuro2 MKI67 (shuffled Nterm) (Homo sapiens) Gerlich Sep 14, 2022
177133 pGEX4T3-GST-PolB(T304I) PolB (Homo sapiens) Sobol Sep 14, 2022
183748 EGFP-Ki67-mCherry MKI67 (Homo sapiens) Gerlich Sep 14, 2022
187654 pIRES-Puro-MGMT MGMT (Homo sapiens) Sobol Sep 14, 2022
187775 MAC_C_RET RET (Homo sapiens) Varjosalo Sep 14, 2022
187766 MAC_C_ROS1 ROS1 (Homo sapiens) Varjosalo Sep 14, 2022
187769 MAC_C_FLT4 FLT4 (Homo sapiens) Varjosalo Sep 14, 2022
167910 pSB700 lenti gRNA mcherry Chavez Sep 14, 2022
189669 pTriEX-Antenna-GDI RhoA RhoA (Homo sapiens) Hahn Sep 14, 2022
187292 IL2-AHDC2-2A-CherryRhoAQ63L in pmCherryN1 interleukin-2 receptor alpha-subunit, anillin, RhoA (Homo sapiens) Yap Sep 14, 2022
167899 NAX_CAGGS_CAS9_m4_KRAB-MeCP2_Hygro dCas9-KRAB-MeCP2 (Synthetic) Chavez Sep 14, 2022
167898 NAX_CAGGS_CAS9_m4_KRAB-MeCP2_EYFP dCas9-KRAB-MeCP2 (Synthetic) Chavez Sep 14, 2022
187295 pTripz Ctrl-IRES-mCherry IRES-mCherry (Mus musculus) Yap Sep 14, 2022
187296 GFP-ROCK1 Rock1 (a.k.a. 1110055K06Rik, Rock-I) (Mus musculus) Yap Sep 14, 2022
190197 pGES201 spCas9 (Other) Guan Sep 14, 2022
101679 pAB143 LAA-tagged mCherry under T7 promoter control Khammash Sep 13, 2022
187692 pLenti-Zyxin-Full Length (aa1-564)-EGFP Zyxin (Mus musculus) Beckerle Sep 13, 2022
187697 pLenti-Zyxin-E (aa1-138)-EGFP Zyxin (Mus musculus) Beckerle Sep 13, 2022
190242 pSelect-2 LacI (Other) Ostermeier Sep 13, 2022
190245 pSelect-9 LacI (Other) Ostermeier Sep 13, 2022
187686 pLenti-Lifeact EGFP Lifeact (Other) Beckerle Sep 13, 2022
187688 pLenti-Paxillin EGFP Paxillin (Gallus gallus) Beckerle Sep 13, 2022
190198 pGES401 spCas9 (Other) Guan Sep 13, 2022
187687 pLenti-Lifeact mApple Lifeact (Other) Beckerle Sep 13, 2022
187702 pLenti-Hsp25 S15A/S86A Hsp25 (Mus musculus) Beckerle Sep 13, 2022
185201 pST_CAHS1_PARRC_150-189 (pBS0658) CAHS1_PARRC_150-189 (Other) Silver Sep 13, 2022
188964 pSLiP-G2 dCas9 (Synthetic), sgRNA: gttagacgctgattacatggactagg Lee Sep 13, 2022
188963 pSLiP-G1 dCas9 (Synthetic), sgRNA: atcggtcgcattgttttccactagg Lee Sep 13, 2022
188931 pBS-SKII-3XHA-HALO-NAT 3XHA-HALO-NAT (Synthetic) Buratowski Sep 13, 2022
188928 pBS-SKII-3XHA-eDHFR-Kan 3XHA-eDHFR-Kan (Synthetic) Buratowski Sep 13, 2022
167897 NAX_CAGGS_CAS9_m4_KRAB-MeCP2_EBFP2 dCas9-KRAB-MeCP2 (Synthetic) Chavez Sep 13, 2022
189672 HisSumoOphP HisSumoOphP (Other) Künzler Sep 13, 2022
189671 His8OphMADeltaC6-18mer. His8OphMA∆C6-TEV18mer (Synthetic) Künzler Sep 13, 2022
167894 NAX_CAGGS_CAS9_VPR_mcherry Cas9-VPR (Synthetic) Chavez Sep 13, 2022
167886 NAX_CAGGS_CAS9_m4_VPR_mcherry dCas9-VPR (Synthetic) Chavez Sep 13, 2022
170766 pEA01 xis, int (Other), oriT (Synthetic), pac (Other) Pernodet Sep 13, 2022
172194 pEA03 attR (Synthetic) Pernodet Sep 13, 2022
172193 pEA02 attL (Synthetic) Pernodet Sep 13, 2022
186030 pOP005 Bacterial transcription unit encoding Broccoli-tRNA fluorogenic aptamer (Synthetic) Belogurov Sep 13, 2022
183764 p15_attB(bxb)_lox Davis Sep 13, 2022
183763 pBR_attB(bxb)_ccdB_lox ccdB Davis Sep 13, 2022
183762 pBR_attB(bxb)_lox Davis Sep 13, 2022
183761 pBR_attB(C31)_FRT Davis Sep 13, 2022
183760 Bxb1_AJMA ASAP2f (Synthetic), jRCaMP1b (Synthetic), miRFP703 (Synthetic), ASAP2f (Synthetic) Davis Sep 13, 2022
183759 Bxb1_miRFP703 miRFP703 (Synthetic) Davis Sep 13, 2022