We narrowed to 18,726 results for: IRE
-
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Synthetic, Human)
UseExpression of a fluorescent membrane markerTagsEGFPExpressionMutationPromoterAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Synthetic, Human)
UseTags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable sinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
NGFR 210Y177
Plasmid#27487DepositorUseRetroviralTagsIRES and NGFRExpressionMammalianMutationTyrosine 177 mutated to Phenylalanine (Y177F)PromoterAvailable sinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc
Plasmid#154267PurposeFirefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorInsertIGF-1 P2 Promoter (IGF1 Human)
UseTagsExpressionMammalianMutationPromoterHuman IGF-1 P2 PromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianMutationPromoterCMV-TetOAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTagsDYKDDDDK (FLAG-tag)ExpressionMammalianMutationPromoterCAGAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
px552-U6-gRNA1-U6-gRNA2-CMV-eGFP
Plasmid#211760PurposePaired gRNAs (sgRNA1 and 2) targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.DepositorInsertgRNA1 and gRNA2 targeting VEGF-A (VEGFA Mouse, M. mulatta (rhesus macaque), Human)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3 13Q- I77K Q78K W87K
Plasmid#185908PurposeExpresses ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-I77K, Q78K,W87K (N-terminal ) fused with His-Tag and TEV cleavage sequence (C-terminal).DepositorInsertataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track and point mutations I77K, Q78K and W87K (ATXN3 Synthetic, Human)
UseTags6x His-Tag and TEV cleavage siteExpressionBacterialMutationPoint mutations in Atx3 gene I77K Q78K and W87KPromoterAvailable sinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P1 Promoter-FLuc2P
Plasmid#154261PurposeDestabilized firefly luciferase reporter containing the canonical Human IGF-1 P1 Promoter.DepositorInsertIGF-1 canonical P1 Promoter (IGF1 Human)
UseTagsExpressionMammalianMutationPromoterHuman IGF-1 P1 PromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc2P
Plasmid#154262PurposeDestabilized firefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorInsertIGF-1 P2 Promoter (IGF1 Human)
UseTagsExpressionMammalianMutationPromoterHuman IGF-1 P2 PromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ
Plasmid#178320PurposeMultiplex luciferase reporter vector, with luciferase reporters for the pathways HRE, P53, AP-1, FOXO and SMAD.DepositorInsertsHRE RedFirefly reporter
P53 FLuc reporter
AP-1 Renilla reporter
FOXO NLuc Reporter
SMAD GrRenilla reporter
UseLuciferase and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
Tol2-pA-GI-wt1bDNNterm-E1b-5xUAS-E1b-eGFP-GI-pA-Tol2; gcryst:CFP
Plasmid#135766PurposeThis plasmid can be used to express independently eGFP and a zebrafish wt1b dominant negative isoform (N-terminal domain) from a bidirectional 5xUAS. Also CFP expression under crystallin promoter.DepositorInsertWilms Tumor 1b gene (N-terminal domain) (wt1b Zebrafish)
UseZebrafishTagsExpressionMutationPromoterUASAvailable sinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationPromoterAvailable sinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PCTK3
Plasmid#23710DepositorInsertPCTK3 (CDK18 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pB-CuR-hSOD1
Plasmid#232477PurposeThe inducible PiggyBac Cumate Switch vector (PBQM812A-1 System Biosciences) expressing human SOD1gene including flag -tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianMutationPromoterCMV-CuOAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianMutationPromoterCMV-TetOAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-NLS-HA-TurboID
Plasmid#215075PurposeExpresses NLS-HA-TurboID in mammalian cells from a lentiviral vector.DepositorInsertTurboID (birA )
UseLentiviralTagsNLS-HAExpressionMammalianMutationPromoterCMVAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PARP1
Plasmid#211578PurposeCMV driven PARP1-eGFP expressing construct with IRES-Neomycin selectionDepositorInsertPARP1 (PARP1 Human)
UseTagseGFPExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-PARP1-Apex2–eGFP
Plasmid#211555PurposeA piggyBac vector containing CMV-PARP1-Apex2-eGFP-IRES-Neo cassette.DepositorInsertPARP1 (PARP1 Human)
UsePiggybacTagsApex2-eGFPExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP1-C-Flag
Plasmid#134286PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP1DepositorInsertSREBP1 (Srebf1 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP1 isoform a precursorPromoterEF1aAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PCNA
Plasmid#215117PurposeExpresses mCherry-PCNA in mammalian cells from a lentiviral vector.DepositorInsertPCNA (PCNA Human)
UseLentiviralTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMThy1.1_hDDX5_FL
Plasmid#88873Purposeconstitutive expression of DDX5 in mammalian cellsDepositorInsertDDX5 (DDX5 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterMSCVAvailable sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP2-C-Flag
Plasmid#134287PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP2DepositorInsertSREBP2 (Srebf2 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP2 precursorPromoterCMVAvailable sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV40-EF1a-hBCL10-SO
Plasmid#75256Purposeretroviral expression vector for expression of StrepOne-Tagged human BCL10DepositorInsertBcl10 (BCL10 Human)
UseRetroviralTagsStrepOne TagExpressionMammalianMutationPromoterpMSCV-LTRs, EF1aAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT_5'-xrRNA_NLuc_3'-XAP1
Plasmid#197264PurposeCloning Backbone for enhanced INSPECT expression (5' xrRNA + 3' XAP1). Encodes for intronic IRES-driven NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette. Clone homology arms via BsaI.DepositorTypeEmpty backboneUseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable sinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PARP1-E988K
Plasmid#211580PurposeCMV driven PARP1-E988K -eGFP expressing construct with IRES-Neomycin selectionDepositorInsertPARP1 (PARP1 Human)
UseTagseGFPExpressionMammalianMutationContains E988K mutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT_5'-xrRNA_NLuc_3'-HCV-UTR
Plasmid#197265PurposeCloning Backbone for enhanced INSPECT expression (5' xrRNA + 3' HCV-UTR). Encodes for intronic IRES-driven NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette. Clone homology arms via BsaI.DepositorTypeEmpty backboneUseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable sinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:IL2_SigP:NLuc
Plasmid#197266PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human IL2 locus (exon 3). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertInterleukin-2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable sinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMThy1.1_hDDX5_FL_D248N
Plasmid#88874Purposeconstitutive expression of DDX5 D248N in mammalian cellsDepositorInsertDDX5 (DDX5 Human)
UseRetroviralTagsExpressionMammalianMutationD248NPromoterMSCVAvailable sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV
Plasmid#102421PurposeInducible expression of siRNA resistant mouse Tet1-201 (Ensembl transcript ENSMUST00000050826.13) with HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 (Tet1 Mouse)
UseTagsHAExpressionMammalianMutationModified at the Dharmacon SMARTpool siRNA #2 targ…PromoterTetO-CMVAvailable sinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV Cdk2ap1CAN-HA
Plasmid#178030PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hH4-AVITEV
Plasmid#74051Purposeretroviral expression plasmid for human histone H4 with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman Histone-H4 (H4C16 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationPromoterpMSCV-LTRsAvailable sinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable sinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV
Plasmid#102422PurposeInducible expression of siRNA resistant mouse Tet1-201 (ENSMUST00000050826.13) with mutated catalytic domain (H1620Y & D1622A), HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 catalytic domain mutant (Tet1 Mouse)
UseTagsHAExpressionMammalianMutationH1620Y and D1622A mutations in Tet1 catalytic dom…PromoterTetO-CMVAvailable sinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN2 BSD
Plasmid#92246PurposeTALEN targeting downstream of HTT gene (ELD) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN1 ZEO. TALEN: NN, HD, NN, NN, HD, NG, NN, NI, NN, NN, HD, NI, NN, HD, NI, NNDepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCAGAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN1 ZEO
Plasmid#92245PurposeTALEN targeting downstream of HTT gene (KKR) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN2 BSD. TALEN: HD, NI, NN, HD, NG, NG, HD, HD, NG, HD, NI, NN, HD, HD, NN, HDDepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCAGAvailable sinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc1/bC - AVITEV
Plasmid#74059Purposeretroviral expression plasmid for human NFATc1/bC with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform beta-C (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationPromoterpMSCV-LTRsAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KSM
Plasmid#136553PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-STING L373A with IRSp53 pLxIS
Plasmid#221283PurposeExpression of STING L373A with IRSp53 pLxIS (RLL361NLV) in mammalian cells by retroviral transductionDepositorUseRetroviralTags3xFLAG-4xFKBPExpressionMutationPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53 with STING pLxIS
Plasmid#221281PurposeExpression of IRSp53 with STING pLxIS (NLV265RLL) in mammalian cells by retroviral transductionDepositorUseRetroviralTags3xFLAG-4xFKBPExpressionMutationPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-STING with IRSp53 pLxIS
Plasmid#221282PurposeExpression of STING with IRSp53 pLxIS (RLL361NLV) in mammalian cells by retroviral transductionDepositorUseRetroviralTags3xFLAG-4xFKBPExpressionMutationPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-PARP1–eGFP
Plasmid#211552PurposeA piggyBac vector containing CMV-PARP1-eGFP-IRES-Neo cassette.DepositorInsertPARP1 (PARP1 Human)
UsePiggybacTagseGFPExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-N'-FLAG-HA-NAP1S318A
Plasmid#195410PurposeExpresses FLAG-HA tagged human NAP1 with S318A point mutationDepositorInsertNak associated protein 1 (AZI2 Human)
UseLentiviralTagsFLAG-HAExpressionMammalianMutationSerine 318 turned to AlaninePromoterAvailable sinceOct. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-total_SigP:NLuc
Plasmid#197267PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (both isoforms). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-total homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT_SigP:NLuc
Plasmid#197263PurposeCloning Backbone for INSPECT expression. Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette. Clone homology arms via Esp3I.DepositorTypeEmpty backboneUseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsExpressionMammalianMutationPromoterAvailable sinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV Cdk2ap1ΔN (MT2B2)-HA
Plasmid#178031PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only