We narrowed to 2,344 results for: dcas9
-
Plasmid#216102PurposeCRISPRi, EF1a-driven dCas9-KRAB (ZNF10) (Cas only)DepositorInsertCas9 [Sp]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_662
Plasmid#216101PurposeCRISPRi, EFS-driven dCas9-KRAB (ZNF10) (Cas only)DepositorInsertCas9 [Sp]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP1223
Plasmid#119261Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1171
Plasmid#119253Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1161
Plasmid#119251Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1219
Plasmid#119259Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-C-intein-C-spC9-H840A-N863A-2xNLS-hGH
Plasmid#112211PurposeTargeted DNA methylationDepositorInsertC-terminus of dCas9
UseAAVMutationD10AAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-HF2-BE2
Plasmid#120396PurposeExpresses HF2-BE2 in mammalian cellsDepositorInsertHF2-BE2
ExpressionMammalianMutationMammalian codon-optimized Cas9-HFPromoterCMVAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-1-6
Plasmid#227487Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-6-11
Plasmid#227488Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-1-6
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-7-12
Plasmid#227471Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA033
Plasmid#216013PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-NG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA035
Plasmid#216015PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpRY_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only