We narrowed to 2,362 results for: dcas9
-
Plasmid#227459Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 42kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-36kb-USF
Plasmid#227461Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-36kb-USF
Plasmid#227462Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-33kb-USF
Plasmid#227465Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 33kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-USP
Plasmid#227444Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-24kb-USP
Plasmid#227445Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 24kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-20kb-USP
Plasmid#227446Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 20kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-11kb-USP
Plasmid#227447Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 11kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-7.5kb-USP
Plasmid#227448Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.5kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA033
Plasmid#216013PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-NG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA035
Plasmid#216015PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpRY_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA034
Plasmid#216014PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9-SpG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR
Plasmid#215377PurposeLentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control.DepositorInsertmNeonGreen-3K-1-10
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iSAM
Plasmid#211495PurposeAAVS1 targeting vector containing an all-in-one DOX-inducible system for CRISPRaDepositorInsertsUniSAM insert
TET-ON
Neo Resistance
Insulator
UseCRISPR and Synthetic BiologyTagsT2A-mCherry TagExpressionMammalianPromoterEF1a, NA, Splicing acceptor, and TREGV promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-MLLx3-HSF1
Plasmid#218558PurposeEncodes SFFV promoter-driven MCP-MLLx3-HSF1 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-MLLx3-HSF1
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only