We narrowed to 27,998 results for: STI
-
Plasmid#114078PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-VPR(1.1)DepositorInserthuman codon optimized DNase-inactive (D908A) enAsCas12a fused to VPR activation domain
TagsSV40 NLSExpressionMammalianAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJ202
Plasmid#162675PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating W159C and S238C mutations.DepositorInsertPETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1)
TagsHisExpressionBacterialMutationW159C, S238C; codon optimized for expression in E…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (PGK-Puro)
Plasmid#63214PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interactio. Contains Puromycin selection markerDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T2-Ste7-EE
Plasmid#52681Purposeexpression of constitutively active Ste7 kinase in bacteriaDepositorInsertSte7 (STE7 Budding Yeast)
TagsGST and MycExpressionBacterialMutationS359E/T363E constitutively activePromotertacAvailable SinceApril 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTF-ACE2s
Plasmid#162786PurposeThe extracellular domain of Angiotensin converting enzyme 2 (ACE2) expressionDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
Tags10xHis, FLAG, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJ199
Plasmid#162672PurposepET-21b(+) based plasmid for expression of the putative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with C-terminal His tag, codon optimized for expression in E. coli K12.DepositorInsertPutative MHET hydrolase from Comamonas thiooxydans (Genbank WP_080747404.1) with signal peptide
TagsHisExpressionBacterialMutationcodon optimized for expression in E. coli K12PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-3p
Plasmid#103341PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-3p target (MIR20A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJ197
Plasmid#162670PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating S131G mutation.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1
TagsHisExpressionBacterialMutationS131G; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
NET23 pEGFP-N2 (1174)
Plasmid#62037Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCJ203
Plasmid#162678PurposepET-21b(+) based plasmid for expression of the putative MHET hydrolase from Comomonas thiooxydans (Genbank WP_080747404.1) with deletion of the predicted signal peptide (Phe2:Ala75)DepositorInsertPutative MHETase from Comomonas thiooxydans (Genbank WP_080747404.1) without 75 residue signal peptide
TagsHisExpressionBacterialMutationdeltaF2-A75; codon optimized for expression in E.…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ205
Plasmid#162676PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating C224A anDepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationC224A, C529A; codon optimized for expression in E…PromoterT7/lacAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ198
Plasmid#162671PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating F495I mutation.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationF495I; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ196
Plasmid#162669PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating catalytic mutation, S225ADepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationS225A; codon optimized for expression in E. coli …PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ204
Plasmid#162677PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating C224H and C529F mutations.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationC224H, C529F; codon optimized for expression in E…PromoterT7/lacAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCJ201
Plasmid#162674PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating C224W and C529SS mutations.DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1)
TagsHisExpressionBacterialMutationC224W, C529SS; codon optimized for expression in …PromoterT7/lacAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-5p
Plasmid#103342PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-5p target (MIR20A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-18a-3p
Plasmid#103292PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-18a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-18a-3p target (MIR18A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-18a-5p
Plasmid#103293PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-18a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-18a-5p target (MIR18A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only