We narrowed to 7,945 results for: Lif;
-
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDestTol2-QUAS:NLS-mApple-he1.1:CFP
Plasmid#184814PurposeUsed to generate the Tg(QUAS:NLS-mApple; he1.1:CFP)c718 transgenic lineDepositorInsertQUAS:NLS-mApple-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-mAppleAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-QUAS:NLS-GFP-he1.1:CFP
Plasmid#184815PurposeUsed to generate the Tg(QUAS:NLS-GFP; he1.1:CFP)c682 transgenic lineDepositorInsertQUAS:NLS-GFP-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-GFPAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only