We narrowed to 6,651 results for: human c myc
-
Plasmid#58707PurposeLentiviral shRNA vector for knockdown of human PIK3CDDepositorAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only
-
ppih.001.177.W133A
Plasmid#137655PurposeExpresses N-terminal GST-(His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-mCh
Plasmid#108854PurposeEncodes for human VEGFR2 fluorescently labeled with mCherry on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACTA2_HL-P2A-eGFP-PGK-PuroR-ACTA2_HR
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertGFP
UseCRISPRAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWZL-hygro-FAKWT
Plasmid#216540PurposeThis retroviral plasmid expresses the human wild type PTK2DepositorAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-YFP
Plasmid#108853PurposeEncodes for human VEGFR2 fluorescently labeled with eYFP on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 1-120
Plasmid#112706PurposeExpresses N-terminally FLAG-tagged human RNMT 1-120 in mammalian cellsDepositorInsertRNMT (RNMT Human)
TagsFLAGExpressionMammalianMutationdeleted amino acids 121-476PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 121-476
Plasmid#112707PurposeExpresses N-terminally FLAG-tagged human RNMT 121-476 in mammalian cellsDepositorInsertRNMT (RNMT Human)
TagsFLAGExpressionMammalianMutationdeleted amino acids 2-120PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pLV-hCCND1-HA
Plasmid#174154PurposeLentiviral vector expressing HA-tagged human cyclin D1DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagshemagglutinin (HA)ExpressionMammalianPromoterEF1AAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#2
Plasmid#174153PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#2
Plasmid#174147PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#1
Plasmid#174146PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSF-DUET-C17orf53_1-87-Strep
Plasmid#211433Purposebacterial expression of the N-terminal amino acids 1-87 of human C17orf53 C-terminally fused to a Strep-TagDepositorAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA6
Plasmid#101418PurposeDonor Vector containing GATA6 transcription factor, part of the Human TFome CollectionDepositorInsertGATA6 (GATA6 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA4
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXN1
Plasmid#101445PurposeDonor Vector containing FOXN1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXN1 (FOXN1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXQ1
Plasmid#101628PurposeDonor Vector containing FOXQ1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXQ1 (FOXQ1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only