We narrowed to 8,513 results for: sgrna
-
Plasmid#75112Purposelenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 and EF1AAvailable sinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseTags3XFLAG-Cas9ExpressionMammalianMutationPromoterCBh; U6Available sinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-opti
Plasmid#106280PurposeA version of the CROP-seq plasmid as presented in Datlinger et al. that contains the sgRNA-(F+E)-combined optimized backbone for CRISPRi from Chen et al.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-2BD
Plasmid#234428PurposePlasmid for Streptomyces containing gene of modified Cas9-BD protein and sequence of sgRNA cloning templateDepositorInsertModified Cas9 with polyaspartate linking
UseTagsExpressionBacterialMutationLinked polyaspartate using glycine-serine linkerPromoterAvailable sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCRISPomyces-2BD
Plasmid#234429PurposePlasmid for Streptomyces containing gene of modified dCas9-BD protein and sequence of sgRNA cloning templateDepositorInsertModified dCas9(D10A, H840A) with polyaspartate linking
UseTagsExpressionBacterialMutationLinked polyaspartate using glycine-serine linkerPromoterAvailable sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro-moxGFP
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9
Plasmid#135964PurposeExpresses SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Nme2Cas9_AAV
Plasmid#119924PurposeAll-in-one AAV plasmid expressing Nme2Cas9 with sgRNA cassetteDepositorInsertNme2Cas9
UseAAVTagsNLS-3xHA-NLS and NLS-NLSExpressionMammalianMutationPromoterU1aAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
HuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
Plasmid#222994PurposeMammalian expression of iGeoCas9(C2) construct with EGFP-targeting sgRNADepositorInsertHuEx-2xNLS-iGeoCas9(C2)-2xNLS_EGFP-g1
UseCRISPRTagsPuroExpressionMammalianMutationPromoterpCAGAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS148∙CsR
Plasmid#197858PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Ap/Cb resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPEM7Available sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW-IRF4-Puro
Plasmid#123323PurposeLentiviral vector for expression of IRF4 under a Doxycycline inducible promoterDepositorInsertIRF4 (IRF4 Human)
UseLentiviralTagsExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterDoxycycline inducible minimal CMVAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasso
Plasmid#207530PurposeConditionally-replicating in Pseudomonas plasmid for cytidine base editing based on pS44i8GH-2; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP; Pm→CBE:SpRY, PEM7→non-specific sgDepositorInsertcytidine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→CBE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorTagsExpressionMutationPromoterAvailable sinceFeb. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-mScarlet
Plasmid#227274PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing mScarlet. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-mScarlet cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-moxGFP
Plasmid#227273PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-moxGFP cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC154-dual-dCas9VP160-sgExpression
Plasmid#48240PurposeDual expression construct expressing both dCas9VP160 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA-Tag, HA-tag, and VP160ExpressionMammalianMutationD10A H840APromoterAvailable sinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMCB619
Plasmid#171011PurposeCRISPR sgRNA vector (puro-BFP with BstXI/BlpI digest sites).DepositorInsertU6:sgRNA_Puro-T2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermU6Available sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC EJ7-GFP
Plasmid#113617PurposeReporter for canonical-NHEJ. Reporter for end joining between two double-strand breaks, induced with the 7a and 7b sgRNAs with CAS9. EJ between the distal ends w/o indel mutations restores GFPDepositorInsertEJ7-GFP variant of EGFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAblo
Plasmid#207528PurposeConditionally-replicating in Pseudomonas plasmid for adenine base editing based on pS44i8GH-2; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b→msfGFP; Pm→ ABE:SpRY, PEM7→non-specific sgDepositorInsertplasmid for adenine base editing; oriV(pRO1600/ColE1), xylS, Pm→repA, P14b→msfGFP; Pm→ ABE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorTagsExpressionMutationPromoterAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-Tet1-CD
Plasmid#83340PurposeTo introduce dCas9-fused Tet1-CD and sgRNA2.0 systemDepositorInsertdCas9-Tet1-CD and sgRNA scaffold with 2xMS2 binding sites
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterU6, CBHAvailable sinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRubiG-T2A-Cas9
Plasmid#75348PurposeUbiquitin promoter expresses GFP and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and RetroviralTagsGFP (via t2a)ExpressionMammalianMutationPromoterUbiquitinAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRubiC-T2A-Cas9
Plasmid#75347PurposeUbiquitin promoter expresses mCherry and humanized spCas9 (PX330) via a T2A motif. For cell transfection or use in retroviral (MMuLV) packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and RetroviralTagsmCherry (via t2a)ExpressionMammalianMutationPromoterUbiquitinAvailable sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
retro-gRNA-eGFP
Plasmid#116926PurposeRetrovirus expressing eGFP with BBSI cloning sites for sgRNADepositorInserteGFP
UseRetroviralTagsExpressionMutationPromoterEF1aAvailable sinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-mcBEST
Plasmid#209416PurposePlasmid for multiplexed cytosine base editing in streptomycetesDepositorInsertsCodon optimized APOBEC1-nCas9-UGI fusion protein
csy4 from Pseudomonas aeruginosa PAO1
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterbase editing cassette: PtipA ; sgRNAs: PkasO* an…Available sinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-BbsI-GGsite-mCherry-Puro
Plasmid#221232PurposeCloning vector for sgRNA with mCherry and PuroDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NS3-NLS/VPR
Plasmid#112244PurposeEncodes the drug-preservable Cas9-NS3-NLS/VPR, which can be used to activate gene expression when combined with an NS3 inhibitor and appropriately designed sgRNA.DepositorInsertdCas9-NS3-NLS/VPR
UseTagsAU1 (N term on NS3) and HA (C term on NS3)ExpressionMammalianMutationNS3 mutant T54APromoterCMVAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2 control
Plasmid#217443PurposeLentiviral vector expressing Cas9 without a targeting sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
retro-gRNA-mRFP1
Plasmid#112914PurposeRetrovirus expressing mRFP1 with BBSI cloning sites for sgRNADepositorInsertmRFP1
UseRetroviralTagsExpressionMutationPromoterEF1aAvailable sinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorInsertgRNA targeting ATG5 (ATG5 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZR158_Lenti-U6-gRNA-10xCS1-PP7_hPGK-PCP-P65-HSF1-Puro
Plasmid#180273PurposeLentiviral expression vector for CRISPRa-SAM sgRNA with 10x capture sequence, and PCP-P65-HSF1 cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pLAT1_Cas9
Plasmid#104907PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC152-dual-dCas9VP64-sgExpression
Plasmid#48238PurposeDual expression construct expressing both dCas9VP64 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA Tag, HA-Tag, and VP64ExpressionMammalianMutationD10A;H840APromoterAvailable sinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC 4-μHOM
Plasmid#113619PurposeReporter for Alt-EJ, variant of EJ7-GFP. Double strand breaks are induced with the 7a & 7h, or 7a & 7i sgRNAs, with CAS9. EJ using 4 nt of microhomology causes a deletion mutation and restores GFPDepositorInsert4-μHOM variant of EGFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_hPGK1_mScarlet-I-TOSI_Donor
Plasmid#178087PurposeHDR donor plasmid to introduce the mScarlet-I mTOR signaling indicator (TOSI) cassette to AAVS1 using AAVS1 T2 sgRNA.DepositorInsertmScarlet-I mTOR signaling indicator (TOSI)
UseCRISPRTagsExpressionMammalianMutationPromoterHuman PGK1Available sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HuEx-2xNLS-iGeoCas9(C1)-2xNLS_EGFP-g1
Plasmid#222993PurposeMammalian expression of iGeoCas9(C1) construct with EGFP-targeting sgRNADepositorInsertHuEx-2xNLS-iGeoCas9(C1)-2xNLS_EGFP-g1
UseCRISPRTagsPuroExpressionMammalianMutationPromoterpCAGAvailable sinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTPH413
Plasmid#185728PurposeBacterial PAM profiling of adenine base editor variantsDepositorInsertsecTadA(8e)-neNme2-C
Nme2Cas9 sgRNA
UseCRISPRTagsExpressionBacterialMutationNme2Cas9 P6S/D16A/E33G/K104T/D152A/F260L/A263T/A3…PromoterAvailable sinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
BB3cN_pGAP_23*_pPFK300_Cas9
Plasmid#104911PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTCDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorInsertTERT sgRNA (TERT Human)
UseTagsExpressionMammalianMutationPromoteru6Available sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
HuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
Plasmid#222992PurposeMammalian expression of iNme2Cas9 construct with EGFP-targeting sgRNADepositorInsertHuEx-1xNLS-iNme2Cas9-npNLS_EGFP-T1
UseCRISPRTagsPuroExpressionMammalianMutationPromoterpCAGAvailable sinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only