We narrowed to 1,461 results for: abo.1
-
Plasmid#191297PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, R166Q TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_F31YG121VDHFR_R166QTS
Plasmid#191299PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationF31Y/G121V DHFR, R166Q TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_WTDHFR_R127ATS
Plasmid#191300PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationWT DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_D27NDHFR_R127ATS
Plasmid#191301PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationD27N DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FDHFR_R127ATS
Plasmid#191302PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_G121VDHFR_R127ATS
Plasmid#191303PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_F31YG121VDHFR_R127ATS
Plasmid#191304PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationF31Y/G121V DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FG121VDHFR_R127ATS
Plasmid#191305PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F/G121V DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_D27NDHFR_WTTS
Plasmid#191283PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationD27N DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FDHFR_WTTS
Plasmid#191284PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_G121VDHFR_WTTS
Plasmid#191285PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FG121VDHFR_WTTS
Plasmid#191286PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F/G121V DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_F31YG121VDHFR_WTTS
Plasmid#191287PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationF31Y/G121V DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_WTDHFR_Q33STS
Plasmid#191288PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationWT DHFR, Q33S TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FDHFR_Q33STS
Plasmid#191290PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F DHFR, Q33S TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_G121VDHFR_Q33STS
Plasmid#191291PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, Q33S TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-Dual_BNIP3(1-158aa)-THROMBIN-GST (E44A L47A D49A A50K Q51A; deltaWIPI2)
Plasmid#223777PurposeExpression of recombinant protein for purificationDepositorInsertBNIP3 soluble part (BNIP3 Human)
TagsThrombin cleavage-GSTExpressionInsectMutationE44A L47A D49A A50K Q51A; disrupts WIPI2 bindingAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEW8
Plasmid#84238PurposePlasmid containing a P2A peptide (porcine teschovirus-1 derived) sequence that works efficiently in Saccharomyces cerevisiaeDepositorInsertHA-mRuby-P2A-eGFP
TagsHA-mRuby and eGFPExpressionYeastPromoterGPDAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET29b-pld
Plasmid#128795Purposeexpresses E. coli PLD in bacteriaDepositorInsertPhospholipase D
TagsHis6ExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only