We narrowed to 1,931 results for: sfGFP
-
Plasmid#215291PurposeExpresses sfGFP under the Anderson J23113 promoter with an RSF1010 backbone.DepositorInsertsfGFP
TagsHisExpressionBacterialPromoterJ23113Available sinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_D-AtUBI10-NbGP41-sfGFP-VP64-GB1
Plasmid#202012PurposeMoclo level 1 - Module D, Promoter: AtUBI10, Gene: NbGP41P-sfGFP-VP64-GB1, Terminator: pea rbcsE9DepositorInsertNbGP41-sfGFP-VP64-GB1
UseSynthetic Biology; Moclo level 1 vectorTagsGB1 and sfGFPPromoterAtUBI10Available sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
H2B-sfGFP-T2A-iCre
Plasmid#178546PurposepCMV-Histone H2B-sfGFP-T2A-iCre-bpA-FRT-Neo*-FRTDepositorInsertHistone H2B-sfGFP-T2A-iCre
UseCre/Lox and Mouse Targeting; Flp/frtExpressionMammalianAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVY-3 sfGFP-tag3
Plasmid#194618Purposefluorescent proteins with cationic peptide tags to promote biomolecular condensate formation in E. coliDepositorInsertsfGFP-K(GGSKKRKKR)3
TagsKGGSKKRKKRGGSKKRKKRGGSKKRKKR and MGHHHHHGGAExpressionBacterialPromoterT7Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT sfGFP 150TAG
Plasmid#154771Purposeplasmid with 4xhybrid PylT cassette (Mx1201 G1 PylT hybrid ) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAGPromoterEF1Available sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAG 150TAA
Plasmid#154776Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAG 150 TAA stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAG 150TAA in GFP reporter, hybrid PylT with A…PromoterEF1Available sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAA 150TAG
Plasmid#154777Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAA 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAA 150TAG in GFP reporter, hybrid PylT with …PromoterEF1Available sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-CBE-Cas9n-Act3.0
Plasmid#178955PurposeIt consists of a Cas9 nickase (D10A) fused with a cytidine deaminase (A3A/Y130F) and MS2-SunTag-activators (ScFv-sfGFP-2xTAD), enabling simultaneous C to T conversion and gene activation.DepositorInserthA3A-zCas9-UGI-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNP1 sfGFP toehold switch
Plasmid#107355PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 sfGFP trigger is co-expressedDepositorInserttoehold 7 + sfGFP
ExpressionBacterialPromoterT7Available sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFA-GFP
Plasmid#133009PurposepFA carrying a sfGFP geneDepositorInsertsfGFP
Tags6xhisExpressionBacterialPromotertetRAvailable sinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TO-dCas9-3XGFP
Plasmid#64107PurposeExpression of Sp dCas9-3XGFP in mammalian cellsDepositorInsertSp dCas9
UseLentiviralTags3XsfGFPExpressionMammalianPromoterCMV-TOAvailable sinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pVP144
Plasmid#222081PurposeSingle component CRISPR-mediated base-editor for Agrobacterium genetic engineering visually marked with sfGFP for guide insertion and eforRED for plasmid eviction.DepositorInsertdCas9-PmCDA1, sfGFP, sacB and eforRED
UseCRISPRExpressionBacterialAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY153
Plasmid#130951Purposereporter circuit (PpspA-2G6 with sfgfp::ASV)DepositorInsertsfgfp
UseSynthetic BiologyTagsASV tagExpressionBacterialPromoterPpspA-2G6Available sinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCTK097
Plasmid#248460PurposeEncodes sfGFP as a Type 3a part to be used in the CTK/YTK systemsDepositorInsertsfGFP
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable sinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCTK080
Plasmid#248443PurposeEncodes sfGFP as a Type 3 part to be used in the CTK/YTK systemsDepositorInsertsfGFP
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable sinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBEL2838
Plasmid#231677PurposeExpresses cytoplasmic sfGFP in mammalian cellsDepositorInsertsfGFP
TagssfGFPExpressionMammalianAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDnaN-sfGFP
Plasmid#207246PurposeIntegrative plasmid for expressing DnaN-sfGFP in Caulobacter crescentusDepositorInsertDnaN(3' end)-sfGFP
TagssfGFPExpressionBacterialAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only