We narrowed to 7,609 results for: trac
-
Plasmid#49076PurposeExpresses human NKCC1 C1052S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC1052S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C791S (NT572)
Plasmid#49074PurposeExpresses human NKCC1 C791S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC791S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C543M (NT360)
Plasmid#49068PurposeExpresses human NKCC1 C543M mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC543M in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S,C724V (NT501)
Plasmid#49073PurposeExpresses human NKCC1 C723S and C724V mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC723S,C724V in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630S (NT400)
Plasmid#49072PurposeExpresses human NKCC1 C630S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC630S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630A (NT399)
Plasmid#49071PurposeExpresses human NKCC1 C630A mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC630A in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C295A (NT104)
Plasmid#49067PurposeExpresses human NKCC1 C295A mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC295A in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C295S (NT103)
Plasmid#49066PurposeExpresses human NKCC1 C295S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC295S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIG-749_HA-GD2-28z_CAR_TFAP4
Plasmid#207490PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-806_HA-GD2-28z_CAR_RFP-TFAP4
Plasmid#207493PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-851_HA-GD2-28z_HA-TFAP4
Plasmid#207501PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertHA-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-852_HA-GD2-28z_TFAP4-HA
Plasmid#207502PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4-HA, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma10-GFP2
Plasmid#166779PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma10-GFP2 (GNG10 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma5-GFP2
Plasmid#166777PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma5-GFP2 (GNG5 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma4-GFP2
Plasmid#166776PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma4-GFP2 (GNG4 Human, Synthetic)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-hPGK-Blast-2A-STING-mNeonGreen
Plasmid#227186PurposeLentiviral expression plasmid encoding STING-mNeonGreen under hPGK promoterDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
3` CC: Hygro – H2B-GFP-N – loxP – mScarlet
Plasmid#219565Purpose3` circularization cassette to induce Cre-mediated circularization of a genomic region flanked by loxP sites with H2B-GFP reconstitution and mScarlet expression from the chromosomeDepositorInsertHygroR_2A_H2B-GFP-N_loxP_mScarlet
UseUnspecifiedPromoterEF-1aAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaQ-RLuc8
Plasmid#140982PurposeEncodes a G alpha subunit (GNAQ) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaQ-RLuc8 (GNAQ Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai1-RLuc8
Plasmid#140973PurposeEncodes a G alpha subunit (GNAl1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai1-RLuc8 (GNAI1 Human)
UseSynthetic BiologyExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only