We narrowed to 4,523 results for: ARA-2
-
Plasmid#164622PurposeExpresses LRRK2 tagged with APEX2 and 3xFLAGDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLVX-Puro-mGSDME F2A
Plasmid#154878PurposeExpresses mGSDME F2A in mammalian cellsDepositorAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR-Flag-IKKbeta-KM
Plasmid#15466DepositorInsertIkB kinase beta-KM (Ikbkb Mouse)
TagsFlagExpressionMammalianMutationchanged Lysine at 44 to AlanineAvailable SinceOct. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLD1
Plasmid#160805PurposeExpress POLD1DepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-OptoFGFR1-Y766F
Plasmid#59777PurposeExpresses optoFGFR1 with mutation in PLC-gamma binding phosphotyrosine site of FGFR1DepositorAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET51b-Strep-hAGT-His
Plasmid#167276PurposeOverexpression of the human o_-alkylguanine-dna alkyltransferase in E. coliDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp2-a C2AB
Plasmid#40051DepositorInserthSlp2-a C2AB (SYTL2 Human)
TagsEGFPExpressionMammalianMutationC2AB domains only (aa 597-910)PromoterCMV promoterAvailable SinceOct. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Slp2-a E11A/R32A
Plasmid#40055DepositorInsertSlp2-a E11A/R32A (Sytl2 Mouse)
TagsEGFPExpressionMammalianMutationGlutamate 11 to Alanine, Arginine 32 to AlaninePromoterCMV promoterAvailable SinceNov. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Btsz2
Plasmid#40068DepositorAvailable SinceOct. 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-flag-mAdrb1-WPRE
Plasmid#223671PurposeAAV expression of flag-mAdrb1 from GfaABC1D promoterDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-flag-mAdrb1-mNeonGreen-WPRE
Plasmid#223672PurposeAAV expression of flag-mAdrb1-mNeonGreen from GfaABC1D promoterDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1_GST-GBRPL1
Plasmid#223729PurposeExpression of recombinant protein for purificationDepositorInsertGABARAPL1 (GABARAPL1 Human)
TagsGSTExpressionBacterialMutationaa 2-116 only, with Glycine exposedAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc
Plasmid#226718PurposePlasmid enabling yeast-mediated expression and secretion of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
TagsHA tag and Mating factor alpha secretion signalExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_FtoW
Plasmid#224254PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_FtoWDepositorInserthnRNPA1_FtoW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationF17W, F25W, F31W, F37W, F43W, F62W, F69W, F78W, F…PromoterT7Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C N-terminal deletion (NT96)
Plasmid#50914PurposeExpresses human NKCC1 with truncation of N-terminus and mutations at P676C I730C. Contains an N-terminal 3xFLAG-YFP tag for expression in mammalian cellsDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C N-term deletion of aa13-222 in hNKCC1…PromoterCMVAvailable SinceFeb. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V A735C (NT549)
Plasmid#50910PurposeExpresses human NKCC1 C723S C724V A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V A735C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 A675C C723S C724V A735C (NT847)
Plasmid#50865PurposeExpresses human NKCC1 A675C C723S C724V A735C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationA675C C723S C724V A735C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S C724V V729C (NT543)
Plasmid#50907PurposeExpresses human NKCC1 C723S C724V V729C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and YFPExpressionMammalianMutationC723S C724V V729C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only