We narrowed to 893 results for: Px330
-
Plasmid#171504Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pX330A-Blimp1-L2-#1
Plasmid#171505Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L2-#2
Plasmid#171506Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L3-#1
Plasmid#171509Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L3-#2
Plasmid#171510Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L4-#1
Plasmid#171511Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-L4-#2
Plasmid#171512Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A_FokI-1x5
Plasmid#63605PurposeExpresses FokI-dCas9 and gRNADepositorInsertFokI-dCas9
UseCRISPRExpressionMammalianPromoterCBhAvailable sinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-ex1-#1
Plasmid#171507Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Prdm14-ex1-#2
Plasmid#171508Purposedeletion of a genomic locus in Prdm14 geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ULK1 KO sgRNA
Plasmid#207561PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCCCGCCTGCGCCATGGAGCC
ExpressionMammalianPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG16L1 sgRNA
Plasmid#207563PurposepX330 expressing Cas9 and a sgRNA targeting the ATG16L1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGCAGCAAGTGACATGTCGTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-moxGFP
Plasmid#227273PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-moxGFP cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-mScarlet
Plasmid#227274PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing mScarlet. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-mScarlet cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ATG5 sgRNA
Plasmid#207555PurposepX330 expressing Cas9 and a sgRNA targeting the ATG5 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAACTTGTTTCACGCTATATC
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYFP-NEAT1m_v1-RT
Plasmid#97089PurposeEncodes a HR repair template for knock-in a YFP expression cassette downstream of the poly(A) signal of human NEAT1_1 isoform. Best used with px330-NEAT1m_v1 vector.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNEAT1m_v1-RT (NEAT1 Human)
UseCRISPRTagsEYFPPromoterCMVAvailable sinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only