We narrowed to 13,986 results for: crispr grnas
-
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA_PDS
Plasmid#46966PurposeExpresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoterDepositorInsertAtU6p::sgRNA_PDS
UseCRISPR; Plant expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-non-target
Plasmid#129465PurposeDerived from pSCB2-sgRNA. 20 nucleotide sequence added as sgRNA binding region by inverse PCR. Used as a negative control.DepositorInsertNon-target/random gRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Elf5 gRNA
Plasmid#128836PurposegRNA for targeting mouse Elf5 loci using CRISPR-cas techniqueDepositorInsertmElf5 gRNA (Elf5 Mouse)
UseCRISPRAvailable SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYJ33-lenti-U6-Oct4-PE-acti-gRNA-DsRed
Plasmid#131076PurposeActivation of Mafa via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpCas9-GFP-U6-gRNA
Plasmid#79144PurposeAll-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSCDepositorInsertSpCas9
UseCRISPRTags2A-GFPExpressionMammalianPromoterCAGAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA1-28-pA
Plasmid#55200PurposePlasmid encoding the Triplex/gRNA architecture.This is a modified form of the original plasmid described in the paper (Construct 3). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spa)_ctrA
Plasmid#133342Purposefor constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hNEUROD1 gRNA_1-MS2-Puro
Plasmid#192676PurposeLentiviral expression of sgRNA targeting hNEUROD1 promoter to activate human NEUROD1 transcriptionDepositorInsertHuman NEUROD1 activating gRNA #1 (NEUROD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA1
Plasmid#133340Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the non-template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spy)_ctrA
Plasmid#133334Purposefor constitutive expression of a single guide RNA from Streptococcus pyogenes with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only