We narrowed to 6,483 results for: nls
-
Plasmid#239485PurposeEncodes a CRISPR/dCas9-based fusion protein designed for targeted DNA methylation.DepositorInsertRPS5A-MQ1v-XTEN80-NLS-dCas9-2xNLS-XTEN16-BFP
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MQ1v-dCas9-cSRDX (M40)
Plasmid#239486PurposeEncodes a CRISPR/dCas9-based fusion protein designed for targeted DNA methylation.DepositorInsertRPS5A-MQ1v-XTEN80-NLS-dCas9-2xNLS-XTEN16-SRDX
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-rNSE-AcGFPnuc-WPRE
Plasmid#245088PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Rat NSE promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterRat NSE promoterAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-mPGK-AcGFPnuc-WPRE
Plasmid#245090PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Mouse PGK promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterMouse PGK promoterAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-mGAD67-AcGFPnuc-WPRE
Plasmid#245086PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Mouse GAD67 promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterMouse GAD67 promoterAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-mD1R promoter-AcGFPnuc-WPRE
Plasmid#245087PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Mouse D1R promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterMouse D1R promoterAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-rTAC1-AcGFPnuc-WPRE
Plasmid#245089PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Rat TAC1 promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterRat TAC1 promoterAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIN-GluR1-AcGFPnuc-WPRE
Plasmid#245092PurposeLentiviral vector with nuclear fluorescent reporter AcGFP expressed from Rat GluR1 promoterDepositorInsertAcGFP
UseLentiviralTags3x SV40 NLSExpressionMammalianPromoterRat GluR1 promoterAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT-Cas9
Plasmid#239382PurposeFor circular RNA-mediated inverse prime editor using WTCas9 in HEK294T cellsDepositorInsertCas9
UseCRISPRTagsBPNLS and SV40 NLSExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG3666_pGEEC576_pShip-EFS-ZF43a(inducible)-P2A-iRFP720-bGH
Plasmid#239740PurposePlasmid expressing a rapamycin-inducible transcriptional activatorDepositorInsertNLS-FXBP-ZF43-P2A-NES-VP64-FRB-P2A-iRFP720
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT44
Plasmid#223416PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for monocot plants; TTTV PAM; LbCas12a-D156R and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-LbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT49
Plasmid#223421PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT50
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT52
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only