We narrowed to 6,962 results for: pcDNA3.1+
-
Plasmid#166811PurposeMammalian cell expression vector for FLAG-tagged NLRP1. LL1193EE and P1214R mutations abolish DPP9 association, K1277E abolishes UPA-UPA contactsDepositorInsertNLRP1 (NLRP1 Human)
TagsFLAGExpressionMammalianMutationLL1193EE, P1214R, K1277EPromoterCMVAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG LL1193EE P1214R
Plasmid#166810PurposeMammalian cell expression vector for FLAG-tagged NLRP1. LL1193EE and P1214R mutations abolish DPP9 association.DepositorAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG LL1193EE
Plasmid#166805PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The LL1193E mutant abolishes FL-NLRP1 association with DPP9 at interface I.DepositorAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG K1277E
Plasmid#166808PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The K1277E mutant abolishes interface III UPA-UPA contacts, DPP9 binding, and inflammasome activityDepositorAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG H1276G
Plasmid#166807PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The H1276G mutant abolishes interface III UPA-UPA contacts, DPP9 binding, and inflammasome activityDepositorAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1 UPA-CARD-FLAG H1276G
Plasmid#166812PurposeMammalian cell expression vector for FLAG-tagged UPA-CARD of NLRP1. The H1276G mutant abolishes interface III UPA-UPA contacts, DPP9 binding, and inflammasome activityDepositorAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1 UPA-CARD-FLAG K1277E
Plasmid#166813PurposeMammalian cell expression vector for FLAG-tagged UPA-CARD of NLRP1. The K1277E mutant abolishes interface III UPA-UPA contacts, DPP9 binding, and inflammasome activityDepositorAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG P1214R
Plasmid#166806PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The P1214R patient mutant abolishes NLRP1-CT association with DPP9 at interface II.DepositorAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
LHD(B)-NovoSplit657(B)-mNeonGreen
Plasmid#255884PurposeExpression plasmid for NovoSplit657(B), the second part of the NovoSplit system, fused to mNeonGreen for fluorescence labeling, and LHD(B)DepositorInsertNovoSplit657(B)
TagsLHD(B) and mNeonGreenExpressionMammalianPromoterCMVAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tom70-NovoTag657(cv)
Plasmid#255880PurposeExpression plasmid for NovoTag657(cv), a NovoTag657 variant for covalent binding, fused to the mitochondrial localization signal Tom70DepositorInsertNovoTag657(cv)
TagsTom70ExpressionMammalianPromoterCMVAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HYlight(low)
Plasmid#255886PurposeExpresses HYlight(low) cytosolically in mammalian cellsDepositorPublicationInsertHYlight2-low
ExpressionMammalianMutationG92D, G125V, V143M, S267C, S398T, T416I, K498R, S…PromoterCMVAvailable sinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSFV_eGFP-P2A-luc2pre (3'UTR)_RLEloop
Plasmid#240255PurposeAttenuated PROTEUS vector with eGFP-LUC transgene. Package VLVs with an envelope-expressing vector such as pCMV-VSV-G, or a transgene-responsive VSV-G expression vector.DepositorInsertEGFP-P2A-firefly luciferase
ExpressionMammalianPromoterSFV subgenomic promoterAvailable sinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKlab810-bGlobin_3xFLAG-BRCA1(full-length)
Plasmid#249023PurposeThis plasmid expresses the full length BRCA1 sequence with an N-terminal 3xFLAG tagDepositorAvailable sinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
MOR-nLuc
Plasmid#231813PurposeRat MOR C-terminally tagged with nLucDepositorAvailable sinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
HRV-3C Protease-mCherry
Plasmid#243792PurposeEncodes for mammalian expression of HRV-3C protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHRV-3C protease
ExpressionMammalianAvailable sinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGR721 - SLD3p-TP-DNAP1.Badboy2
Plasmid#222013PurposeExpresses the Badboy2 TP-DNAP1 variant under control of a weak promoter for reducing p1 copy numberDepositorInsertTP-DNAP1 BadBoy2
ExpressionYeastPromoterSLD3pAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS1742
Plasmid#239838PurposeOrufIscB-KRK mammalian expressionDepositorInsertOrufIscB-KRK
TagsNucleoplasmin NLS-3xHA and SV40 NLSExpressionMammalianMutationInsertion of REC domain from NbaCas9-1 + E137K/E4…PromoterCMVAvailable sinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-fMCP
Plasmid#238908PurposeContains EGFP-fMCP fluorogenic proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP-fMCP
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-mito-ApplePy1High
Plasmid#239075PurposeMammalian expression of mitochondria-targeted high affinity red fluorescent pyruvate biosensor ApplePy1HighDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertApplePy1High
ExpressionMammalianAvailable sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GreenPy1Highest
Plasmid#239059PurposeMammalian expression of highest affinity green fluorescent pyruvate biosensor GreenPy1HighestDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGreenPy1Highest
ExpressionMammalianAvailable sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only