We narrowed to 16,712 results for: grna
-
Plasmid#200465PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(46) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL007-NANOG-sgRNA
Plasmid#175555PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.DepositorInsertspCas9-nuclease and sgRNA against mouse NANOG STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR8-PspCas13b_gRNA[ccdbCam]_1xMS2b
Plasmid#196847Purposebackbone for gRNA cloning of dpspCas13b tagged by 1xMS2DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-EGFP_cU6:6-sgRNA
Plasmid#190597PurposeThe plasmid encodes S. pyogenes Cas9 and eGFP separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoter.DepositorInsertsCas9
sgRNA
UseCRISPRTagsEGFP - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Hic1 GFP
Plasmid#106953PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.DepositorInsertanti-Hic1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLb-Cpf1-pGL3-U6-sgRNA
Plasmid#107682PurposeExpresses LbCpf1 crRNA in mammalian cellsDepositorInsert
ExpressionMammalianAvailable SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZ148-BhCas12b-sgRNA-scaffold
Plasmid#122448PurposeExpresses sgRNA for BhCas12b in mammalian cellsDepositorInsertU6-BhCas12b-sgRNA-scaffold, CMV-mCherry
ExpressionMammalianAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA1
Plasmid#99734PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-W
Plasmid#67984PurposeCas9 activity reporter with GFP and BFPDepositorInsertsU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ3538 eforRed-targeting sgRNA
Plasmid#239455Purposeguide for eforRedDepositorInsertguide targeting eforRed
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro G3BP1-sgRNA
Plasmid#196197PurposeCas9 + gRNA expression to edit G3BP1 locusDepositorInsertG3BP1 (G3BP1 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA spred1, mitfa:Cas9
Plasmid#118843PurposeTargets spred1 and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInsertspred1 gRNA (spred1 Zebrafish)
UseCRISPR; Tol2Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZDonor-Nm-Cas9-gRNA-hU6
Plasmid#61366Purposeempty backbone for cloning N. meningiditis protospacers. Encodes constant region of N. meningiditis Cas9 synthetic gRNADepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only