We narrowed to 168,560 results for: Gene
-
Plasmid#180480PurposeInducible gene expression vector p13xQUAS-ZsGreen-P2A, α-cry:mCherryDepositorInsert13x QUAS-ZsGreen-P2A
UseSynthetic BiologyAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6
Plasmid#64222PurposeExpression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherry-P2A-E4orf6ExpressionMammalianPromoterCBh and U6Available SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-mScarletP2A-hLuc
Plasmid#218793PurposeAAV reporter genome plasmidDepositorInsertNLSf-mScarletP2A-hLuc
UseAAVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
p13xQUAS-MCS, α-cry:mCherry
Plasmid#180481PurposeInducible gene expression vector p13xQUAS-MCS, α-cry:mCherryDepositorInsertMultiple cloning site
UseSynthetic BiologyAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQFDBD-2x AD*-VP16*, α-cry:EGFP
Plasmid#180473PurposeGene expression vector pQFDBD-2x AD*-VP16*, α-cry:EGFPDepositorInsertQFDBD-2xQFAD*-VP16*
UseSynthetic BiologyAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p9xQUAS-ZsGreen-P2A, α-cry:mCherry
Plasmid#180479PurposeInducible gene expression vector p9xQUAS-ZsGreen-P2A, α-cry:mCherryDepositorInsert9x QUAS-ZsGreen-P2A
UseSynthetic BiologyAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
p17xQUAS-Luciferase, α-cry:mCherry
Plasmid#180482PurposeInducible gene expression vector p17xQUAS-Luciferase, α-cry:mCherryDepositorInsertsLuciferase
17x QUAS
UseSynthetic BiologyAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCA.66/2272
Plasmid#22733DepositorInsertLox66-pU(delta)TK-EM7Neo-Lox2272
UseCre/Lox; Bac recombineeringMutationThis vector was designed for assembling gene targ…Available SinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64219PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2ADepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9-iP-A
Plasmid#60599PurposeExpresses human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertCRISPR Cas9
UseCRISPRExpressionMammalianMutationCodon usage optimized for human usageAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B S. pyogenes, Human, Synthetic)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE-TAZ-CAMTA1
Plasmid#235680PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
1073A(HomeR1)=pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159676PurposePlasmid provides the HomeR#1 gene drive element harboring a rescue, gRNA#1, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #1 via HDR.DepositorInsertpBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#1(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
ExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF
Plasmid#100280PurposeExpression vector for phycocyanobilin (PCB) synthesis in mammalian cells.DepositorInsertMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
hum alpha ENAC promoter a25-a23
Plasmid#83427Purposepromoter reporter construct to test 5' flanking sequencesDepositorInserthuman aENaC gene 5' flanking seq + 55 nt of the 5' UTR for exon 1A (SCNN1A Human)
UseLuciferaseTagsLuciferasePromoteralpha ENACAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTNG4kwh
Plasmid#44722DepositorInsertspCMV-D2i promoter
htetR::NLS::EGFP
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
LoxP1-His-H2B-Cherry-2A (SO290)
Plasmid#99616PurposeTo clone gene of interest downstream of LoxP1-His-H2B-Cherry-2A cassetteDepositorInsert6xHis-H2B-Cherry
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
LoxP2-Mb2Tomato-2A (SO240)
Plasmid#99614PurposeTo clone gene of interest downstream of LoxP2-Mb2Tomato-2A cassetteDepositorInsertMb2Tomato
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only