We narrowed to 6,839 results for: pcDNA3.1+
-
Plasmid#246053PurposeExpression of AcrIIC3-cpGR2 hybrid in mammalian cells; insertion before F59; enables chemogenetic control of NmeCas9DepositorInsertAcrIIC3_cpGR2-F59
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA4_cpGR2(GGS5)-ΔN64_Q65_E66
Plasmid#246052PurposeExpression of AcrIIA4-cpGR2 hybrid in mammalian cells after Bubeck et al Nat Methods 2018; enables chemogenetic control of SpyCas9DepositorInsertAcrIIA4_cpGR2-ΔN64/Q65/E66
UseCRISPR and Synthetic BiologyExpressionMammalianMutationΔN64/Q65/E66Available SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_cpGR2(GGS5)-N77
Plasmid#246046PurposeExpression of AcrIIA5-cpGR2 hybrid in mammalian cells; insertion before N77; enables chemogenetic control of SauCas9DepositorInsertAcrIIA5_cpGR2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_cpGR2(GGS5)-D41
Plasmid#246045PurposeExpression of AcrIIA5-cpGR2 hybrid in mammalian cells; insertion before D41; enables chemogenetic control of SauCas9DepositorInsertAcrIIA5_cpGR2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_AsLOV2-N77
Plasmid#246044PurposeExpression of AcrIIA5-AsLOV2 hybrid in mammalian cells; insertion before N77; enables optogenetic control of SauCas9DepositorInsertAcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_AsLOV2-D41
Plasmid#246043PurposeExpression of AcrIIA5-AsLOV2 hybrid in mammalian cells; insertion before D41; enables optogenetic control of SauCas9DepositorInsertAcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
IMPT-10917
Plasmid#236192PurposeExpress GPR6 in insect cellsDepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHS-MRscRNA
Plasmid#240214PurposeMammalian vector for transient expression of theophylline-responsive MR-scRNA with mCherry transfection markerDepositorInsertTheophylline MR-scRNA targeting TET3G promoter
ExpressionMammalianPromoterU6Available SinceNov. 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hVEGF165-eGFP-hVEGF165 glycosylation sequon-His tag
Plasmid#240484PurposeExpress engineered glycosylated eGFP in CHO cellsDepositorInsertglycosylated eGFP
Tags3 repeats of hVEGF165 glycosylation sequon, 6xHis…ExpressionMammalianAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-huADF WT
Plasmid#245941PurposeExpressing wild type human actin depolymerizing factor (destrin)DepositorAvailable SinceNov. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Neo-2/15-TGFa-SPMn-SpyTag003
Plasmid#246650PurposeExpresses Neo-2/15-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInsertNeo-2/15-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Neo2/…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
tPA-TGFa-SPMn-SpyTag003
Plasmid#246649PurposeExpresses tPA-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInserttPA-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Kringl…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
huADF S3E
Plasmid#245944PurposeExpressing a non-actin binding form (phosphomimetic) of human ADFDepositorInsertactin depolymerizing factor (ADF) (DSTN Human)
ExpressionMammalianMutationS3EPromoterCMVAvailable SinceOct. 22, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
TVMV-HRV-3C Proteases-mCherry
Plasmid#243796PurposeEncodes for mammalian expression of TVMV and HRV-3C protease inputs. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV and HRV-3C proteases
ExpressionMammalianAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-fMCP
Plasmid#238913PurposeContains tdTomato-fMCP fluorogenic proteinDepositorInserttdTomato-fMCP
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TVMV Protease-mCherry
Plasmid#243794PurposeEncodes for mammalian expression of TVMV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV protease
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TVMV-TEV Proteases-mCherry
Plasmid#243797PurposeEncodes for mammalian expression of TVMV and TEV protease inputs. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTVMV and TEV proteases
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-R652A
Plasmid#240605PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2; R was substituted by A at Residue 652 of ACE2 in the collectrin-like siteDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) at position 652 on ACE2 is replaced …PromoterCMVAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-C4
Plasmid#240608PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2, so these amino acids were substituted by A at Cluster 4 located within the collectrin-like site on ACE2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) and Lysine (K) residues on ACE2-clus…PromoterCMVAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only