We narrowed to 7,717 results for: ski
-
Plasmid#127501PurposeExpresses myc-tagged NDUFS2/K62A in mammalian cellsDepositorInsertNDUFS2 K62A (NDUFS2 Human)
Tagsmyc-HisExpressionMammalianMutationNDUFS2 K62APromoterCMVAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/NDUFS2 P63A/myc-His
Plasmid#127502PurposeExpresses myc-tagged NDUFS2/P63A in mammalian cellsDepositorInsertNDUFS2 P63A (NDUFS2 Human)
Tagsmyc-HisExpressionMammalianMutationNDUFS2 P63APromoterCMVAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Anti-Sense
Plasmid#124444PurposePlasmid for anti-sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Gli3_Sense
Plasmid#124439PurposePlasmid for sense in situ probe in vitro transcriptionDepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Kind2 S159/181/666E
Plasmid#105314PurposeTo study altered downstream functions of phospholylation-site mimetic kindlin2DepositorAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ZNF597_WT
Plasmid#82894PurposeGateway Donor vector containing ZNF597, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTight-9-124-BclxL
Plasmid#60857Purpose2nd generation lentiviral transfer plasmid. Expresses a synthetic cluster of miR-9/9* and miR-124 fused to Bcl-xL under a doxycycline-inducible promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NDi-CRISPRi (Gen1)
Plasmid#73497PurposeDox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locus with mCherry markerDepositorInsertsdCas9-KRAB-P2A-mCherry
rtTA
UseCRISPRTagsHA, KRAB, and NLSExpressionMammalianMutationD10A, H840A (catalytically deactivated Cas9)PromoterCAG and TRE3GAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUltra-Hot-PC
Plasmid#184466PurposeLentiviral vector for bi-cistronic expression of mCherry and PC (seperated by P2A)DepositorAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2-HuC(elavl3)-CaMPARI2
Plasmid#137185Purposepan-neuronal expression of CaMPARI2 in zebrafish, used to generate the CaMPARI2 zebrafish line at ZIRC (ZL13801)DepositorInsertHuC(elavl3)-CaMPARI2-FLAG-HA-myc-polyA
UseTol2 plasmid for zebrafishTagsFLAG, HA, mycPromoterHuC(elavl3)Available SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 YFP
Plasmid#84911Purposeexpression of TDP-43 YFP in mammalian cellsDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978)
Plasmid#185910PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9(D10A) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9=D10APromoterCMV and T7Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT-Lyn11-mEGFP-cpHalo∆-(GGS)9-FKBP-P2A-Hpep3-(GGS)3-FRB-mScarlett
Plasmid#205703PurposeCMV driven co-expression of split HaloTag FKBP- and FRB-fusions (Lyn11-EGFP-FKBP-cpHalo∆ and Hpep1-FRB-mScarlett) in mammalian cell linesDepositorInsertLyn11-EGFP-FKBP-cpHalo∆-P2A-Hpep1-FRB-mScarlett
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn CaBLAM
Plasmid#244227PurposeBioluminescent reporter for calcium signaling in neuronsDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NDi-CRISPRi (Gen2)
Plasmid#73498PurposeDox-inducible CRISPR interference (CRISPRi) knock in construct into the AAVS1 locusDepositorInsertsdCas9-KRAB
rtTA
UseCRISPRTagsHA, KRAB, and NLSExpressionMammalianMutationD10A, H840A (catalytically deactivated Cas9)PromoterCAG and TRE3GAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
A24M04 Ig kappa light chain-pFEEKW
Plasmid#234810PurposeExpress Ig kappa light chain containing the VL region of the monoclonal antibody, A24M04, specific for human papilloma virus16 L1DepositorUseLentiviralExpressionBacterial and MammalianPromoterEEK promoterAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC178: pAAV.U6.SapI.CMV.Cas13bt3
Plasmid#204215PurposePlasmid AAV vector expressing Cas13bt3 and hU6-driven expression of guide RNAs. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.DepositorInsertCas13bt3 and U6.SapI sgRNA cloning site
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationCodon optimisation by GenScript toolPromoterCMV/U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-M2rtTA
Plasmid#60843PurposeAAVS1 donor vector for genomic targetingDepositorInsertsM2rtTA
Neo
UseTargeting donorAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only