We narrowed to 9,867 results for: Pol
-
Plasmid#154246PurposePlasmid compatible with non-viral delivery for secretion of trimeric human TRAILDepositorInsertSecretable Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand
ExpressionMammalianPromoterCMV PromoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-HIS-TEV-Cyclin-B
Plasmid#177012PurposeGenerate baculovirus for insect cell expression of Cyclin-B with N-terminal Polyhistidine-TEVDepositorInsertCyclin B1 (CCNB1 Human)
TagsPolyhistidine-TEVExpressionInsectMutationcodon-optimised for insect cell expressionAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP5F1B-turboGFP
Plasmid#239795PurposeExpresses human ATP5F1B tagged with turboGFPDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-His6-LOXCATmut
Plasmid#140085PurposeA control for His6-LOXCAT where LOX is catalytically dead (mutations H265A and R268A)DepositorInsertA fusion of lactate oxidase from A. viridans and catalase from E. coli
TagsHis6ExpressionBacterialMutationMutation in H265A and R268A in LOX (used original…PromoterT7Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458-Cas9 UPF1 sgRNA
Plasmid#251491PurposeCas9 CRISPR gRNA construct; expresses human UPF1 gRNADepositorInsertUPF1 gRNA
ExpressionBacterialAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
LLP339 pGK-dCas9-SunTag
Plasmid#100943PurposedCas9 vector with SunTagx10, driven by pGK, with 3xHA tag, Puro driven by EF1aDepositorInsertdCas9, SunTag array (10xGCN4)
UseCRISPRTags3xHAExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-nsp7-nsp8
Plasmid#159092PurposeCoexpression construct of Nsp7 with an N-terminal His-tag and Nsp8DepositorInsertsNSP7
NSP8
TagsHisExpressionBacterialPromoterT7Available SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Src-Y530F
Plasmid#124659PurposeHuman c-Src with Y530F mutationDepositorAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
PDG458 V3
Plasmid#226959PurposeCBh-SpCas9-2A-GFP, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-HA
Plasmid#61355Purposeencodes c-terminal HA-tagged S. pyogenes dCas9 driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal HA tag
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P REV3L_1
Plasmid#160797PurposeSuppress REV3LDepositorInsertshREV3L_1
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DNA2_2
Plasmid#160780PurposeSuppress DNA2DepositorInsertshDNA2_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P DNA2_1
Plasmid#160779PurposeSuppress DNA2DepositorInsertshDNA2_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL4_10xUAS-CMVmin-BC0396-luc2
Plasmid#227115PurposeBarcoded assay, UAS sensor for split TEV assays; barcode BC0396DepositorInsert10x clustered UAS element linked to CMV minimal promoter driving barcode 0396 and a luciferase reporter gene
ExpressionMammalianAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cas9-NAT
Plasmid#64329PurposeCas9 expression cassette carried by a yeast single-copy episome plasmidDepositorInsertHuman-optimized S. pyogenes Cas9 with Clonnat marker gene expression cassette
UseCRISPRExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2360 - pAAV rActin EGFP donor
Plasmid#228444PurposeAn adeno-associated viral vector to express a SpCas9 guide RNA targeting rat beta actin also carrying an HDR template for insertion of mEGFP to the break site.DepositorInsertmEGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGL4_CRE-CMVmin-BC0481-luc2
Plasmid#227132PurposeBarcoded assay, cAMP/Ca2+ sensor; barcode BC0481DepositorInsert6x clustered CRE element linked to CMV minimal promoter driving barcode 0481 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTMiniTrex-mCherry-Shark2
Plasmid#233144PurposeServes as a template plasmid for amplifying Shark2 (Tet-ON) hammerhead aptazyme-3xTy-tagging cassetteDepositorInsertsmCherry
Shark2
UseProkaryotic expressionTags3x Ty tagMutationCodon optimized for Trypanosoma cruziAvailable SinceMarch 20, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits