-
Plasmid#170117PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorInsertCircular 100,50 guide RNA
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (FANCC)
Plasmid#180192PurposeAAV vector carrying a guide RNA targeting the human FANCC mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (CTNNB1)
Plasmid#180193PurposeAAV vector carrying a guide RNA targeting the human CTNNB1 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (SMAD4)
Plasmid#180191PurposeAAV vector carrying a guide RNA targeting the human SMAD4 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralTagsExpressionMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorInsertCASP8 (CASP8 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorInsertARAF (ARAF Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: TACGTTCTCTATCACTGATPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only