We narrowed to 10,394 results for: ADA
-
Plasmid#208677PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) sensor GRAB_NPY1.0 in a cre-dependent mannerDepositorInsertGPCR activation based neuropeptide Y (NPY) sensor GRAB_NPY1.0
UseAAVPromoterEF1_Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mTet1s pc3901
Plasmid#201700PurposeExpresses of GFP-tagged mTet1s in mammalian cellsDepositorAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX311 MCL1
Plasmid#117729PurposeOpen reading frame vector encoding MCL1DepositorAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S2-cAMPr
Plasmid#160723PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter cAMPr (cAMP indicator), HA tag, and S2 protein scaffold.DepositorInsertS2-cAMPr
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Npl4-Strep-HA
Plasmid#113495PurposeExpression of human Npl4 with C-terminal strep-HA tagDepositorInsertNpl4 (NPLOC4 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCS4 3XFLAG-PPARgamma2
Plasmid#78770PurposeTo overexpress PPARgamma2 in Mammalian CellsDepositorAvailable SinceJune 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-Tq2CFP-OcsT
Plasmid#71268PurposeEntry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTq2CFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_NPY1.0
Plasmid#208675PurposeExpresses the genetically-encoded fluorescent neuropeptide Y (NPY) sensor GRAB_NPY1.0 in mammalian cellsDepositorInsertGPCR activation based neuropeptide Y (NPY) sensor GRAB_NPY1.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1
Plasmid#160807PurposeExpress POLA1DepositorAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-GUS-OcsT
Plasmid#71267PurposeEntry clone containing the GUS enzyme. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertBeta-glucuronidase
UseGatewayTags2xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 2xSTREP Cyclin F(LP35/36AA)
Plasmid#236467Purposetransient overexpression of Cyclin F in mammalian cellsDepositorInsertCyclin F (CCNF Human)
Tags2xSTREPExpressionMammalianMutation(LP35/36AA) first two amino acids of the F-box do…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
BRD4-N CRISPR
Plasmid#140651PurposeBRD4 tagging CRISPRDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
H11-mScarletSIIN
Plasmid#172438PurposeHipp11 targeting vector, expresses mScarlet-SIINFEKLDepositorInsertmScarlet-SIIN
UseMouse TargetingAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-CyOFP1
Plasmid#105799PurposeExpression of your protein of interest in fusion with orange fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 27240196). CyOFP1 is useful for multi-channel imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-CyOFP1ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Ufd1-Strep-HA
Plasmid#113474PurposeExpression of human Ufd1 with C-terminal strep-HA tagDepositorInsertUfd1 (UFD1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits