We narrowed to 26,811 results for: Green Fluorescent Protein
-
Plasmid#217373PurposesfGFP reporter for Bsu pbuE* 2AP riboswitchDepositorPublicationInsertPca rhtB riboswitch sfGFP reporter
Available sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJBL6931
Plasmid#217369PurposesfGFP reporter for WT Pca rhtB ZTP riboswitchDepositorPublicationInsertPca rhtB riboswitch sfGFP reporter
Available sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJBL6951
Plasmid#217373PurposesfGFP reporter for Bsu pbuE* 2AP riboswitchDepositorPublicationInsertPca rhtB riboswitch sfGFP reporter
Available sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSMART-HCKan-yibDp-roGFP2
Plasmid#202462PurposeExpresses redox sensitive GFP (roGFP) after phosphate depletionDepositorInsertreduction-oxidation sensitive green fluorescent protein
ExpressionBacterialPromoteryibDpAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMART-HCKan-yibDp-roGFP2
Plasmid#202462PurposeExpresses redox sensitive GFP (roGFP) after phosphate depletionDepositorInsertreduction-oxidation sensitive green fluorescent protein
ExpressionBacterialPromoteryibDpAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC3-N-GFP-NES
Plasmid#222606PurposeExpression of MAC3-tagged GFP-NES (N-terminal)DepositorInsertEGFP and 3' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NES
Plasmid#222606PurposeExpression of MAC3-tagged GFP-NES (N-terminal)DepositorInsertEGFP and 3' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NLS
Plasmid#222607PurposeExpression of MAC3-tagged GFP-NLS (N-terminal)DepositorInsertEGFP and 3' nuclear localizaition sequence (NLS)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NLS
Plasmid#222607PurposeExpression of MAC3-tagged GFP-NLS (N-terminal)DepositorInsertEGFP and 3' nuclear localizaition sequence (NLS)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-NES
Plasmid#222603PurposeExpression of MAC3-tagged GFP-NES (C-terminal)DepositorInsertEGFP and 5' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-NES
Plasmid#222603PurposeExpression of MAC3-tagged GFP-NES (C-terminal)DepositorInsertEGFP and 5' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable sinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGW1-ExSYTE-P2A-EGFP-DTE
Plasmid#216258PurposeExSYTE (P2A) EGFP with 3'UTR of Rat Arc DTEDepositorInsertExSYTE P2A EGFP - Rat DTE
ExpressionMammalianAvailable sinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGW1-ExSYTE-P2A-EGFP-DTE
Plasmid#216258PurposeExSYTE (P2A) EGFP with 3'UTR of Rat Arc DTEDepositorInsertExSYTE P2A EGFP - Rat DTE
ExpressionMammalianAvailable sinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ExSYTE.H64A
Plasmid#216262Purposeinactive ExSYTE.H64A (P2A) EGFP with 3'UTR of Rat Arc DTE under synapsin promoterDepositorInsertExSYTE P2A EGFP - Rat DTE
UseAAVMutationH64A mutation in each oTetRAvailable sinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ExSYTE.H64A
Plasmid#216262Purposeinactive ExSYTE.H64A (P2A) EGFP with 3'UTR of Rat Arc DTE under synapsin promoterDepositorInsertExSYTE P2A EGFP - Rat DTE
UseAAVMutationH64A mutation in each oTetRAvailable sinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD-P19-EGFP
Plasmid#196609PurposesiRNA vector expressing TMV P19 and a 720-long EGFP sequence as inverted repeatDepositorInsertp19 + EGFP inverted repeat sequence
Tags6x His tagExpressionBacterialPromoterAraCAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-P19-EGFP
Plasmid#196609PurposesiRNA vector expressing TMV P19 and a 720-long EGFP sequence as inverted repeatDepositorInsertp19 + EGFP inverted repeat sequence
Tags6x His tagExpressionBacterialPromoterAraCAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only