We narrowed to 14,273 results for: CAN
-
Plasmid#15718DepositorInsertp15 4xSBR1 (CDKN2B Human)
UseLuciferaseExpressionMammalianMutationMutant SBE (Smad binding element)Available SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBK-EcTrpRS(H14)
Plasmid#231129PurposeExpresses mutant E. coli TrpRS from a weak glnS promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertE. coli tryptophanyl tRNA synthetase
ExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTrpRS(H14)
Plasmid#231131PurposeExpresses mutant E. coli TrpRS from a derepressed lac promoter for proteome-wide incorporation of tryptophan analogues in E. coli/K. pneumoniae.DepositorInsertE. coli tryptophanyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSGAb/pEvol-AbTrpRS(H14)
Plasmid#231133PurposeExpresses mutant A. baumannii TrpRS from an inducible lac promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertA. baumannii tryptophanyl tRNA synthetase
UseAcinetobacter baumannii expressionExpressionBacterialMutationT12A, V151G, V153CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-p53-G609T
Plasmid#229531PurposeExpresses p53 mutant CASM203 in mamallian cellsDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-p53-G609A
Plasmid#229532PurposeExpresses p53 mutant G609A in mamallian cellsDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-p53-G609C
Plasmid#229533PurposeExpresses p53 mutant G609C in mamallian cellsDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only