We narrowed to 18,866 results for: cat.1
-
Plasmid#66747Purposeluciferase reporter for Calb2 promoter (-419 to +80, WT)DepositorInsertCalb2 promoter (-419bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S303A
Plasmid#118363PurposeThis plasmid expresses human HSF1 S303A mutant, which cannot undergo sumoylation on K298 due to disrupted PDSM motif.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTriEx4-ADCY6-C1(306-672 aa)
Plasmid#113903PurposeHis-S tagged cytoplasmic catalytic domain 1 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 1 (ADCY6 Human)
TagsHis-SExpressionBacterial, Insect, and Mamm…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-838;+80pCalb2
Plasmid#66750Purposeluciferase reporter for Calb2 promoter (-838 to +80, WT)DepositorInsertCalb2 promoter (-838bp +80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT21
Plasmid#78102Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 2…PromoterT7Available SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT13
Plasmid#75087Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 4…Available SinceMay 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMB-KO, S199AzF)-HIS
Plasmid#153445PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode B knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJJR50
Plasmid#75026PurposeU6 promoter driven flipped + extended sgRNA expression vectorDepositorInsertguide RNA, flipped and extended version
UseCRISPRPromoterR07E5.16 (U6)Available SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIRT5H158Y-pET15b
Plasmid#81032PurposeBacterial expression of Human catalytic mutant SIRT5 proteinDepositorInsertSirt5 (SIRT5 Human)
TagsHisExpressionBacterialMutationH158Y catalytic mutantPromoterT7Available SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
InsRA-eGFP
Plasmid#79795PurposeInsulin receptor isoform A with a inter-domain eGFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 His-GFP-EWSR1-myc-His
Plasmid#46385Purposeexpresses EGFP tagged EWSR1 in mammalian cellsDepositorAvailable SinceSept. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
InsRA-TagBFP
Plasmid#79791PurposeInsulin receptor isoform A with a inter-domain TagBFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 5, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
anti-Notch1_E6-pBIOCAM5
Plasmid#39344DepositorTags3xFLAG, 6xHis, and human FcExpressionMammalianPromoterCMVAvailable SinceOct. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-N2-6MYC-hMID2
Plasmid#51035Purposemammalian expression of myc-tagged human MID2DepositorAvailable SinceFeb. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
InsRA-EBFP2
Plasmid#79797PurposeInsulin receptor isoform A with a inter-domain EBFP2 tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 5, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-G-Flamp1
Plasmid#188567Purposegreen biosensor for cAMP in mammalian cellsDepositorInsertG-Flamp1
TagsHis tagExpressionMammalianPromoterCAGAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-TRIP12-HECT
Plasmid#241818PurposeExpesses GST-TRIP12 for protein purificationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only