We narrowed to 24,300 results for: cas9
-
Plasmid#215833PurposeTemplate for in vitro transcription of CBE6a (with SpCas9)DepositorInsertCBE6a-SpCas9-2xUGI
UseIn vitro transcription templateAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CRY2Clust-BRD4ΔN
Plasmid#200968Purposeinduction of phase-separated condensate mediated by BRD4dN-IDRDepositorInsertBRD4dN
ExpressionBacterial and MammalianAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMC-J6-dCas9-10XGP41-J9
Plasmid#202005PurposeMoClo level 0 dCas9-10XGP41 coding sequence moduleDepositorInsertdCas9-10XGP41
UseSynthetic Biology; Moclo cloning vectorTagsGS linkersAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Ptet-nCas9-BE
Plasmid#195739PurposeExpress APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coliDepositorPublicationInsertTet repressor protein / APOBEC1-nCas9(D10A)-UGI
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPtet(Tetracycline inducible protein)Available sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-RHOA_sgRNA
Plasmid#183878PurposepX459V2.0-HypaCas9 plasmid with RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-SunTag
Plasmid#158410PurposeCRISPR-dpcoCas9 fused with SunTag recruiting VP64 activators for transcriptional activationDepositorInsertdpcoCas9-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-VP64-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-EV2.1
Plasmid#158411PurposeCRISPR-dpcoCas9 fused with EDLL activator for transcriptional activationDepositorInsertdpcoCas9-EDLL-T2A-MS2-VPR(VP64-p65-Rta)-NOS-ter
UseCRISPRExpressionPlantAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_eA3A T31A-dCas9
Plasmid#163537PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-dCas9
UseCRISPRExpressionMammalianMutationdCas9 (D10A, H840A)eA3A T31AAvailable sinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-eCas9-sgMIB1
Plasmid#140239PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a gRNA targeting human MIB1DepositorInsertsgRNA targeting human MIB1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-R1R2_EF1ap300dCas9VP64_T2A_MS2p65HSF1-IRESbsdpA
Plasmid#113343PurposeExpresses p300-dCas9-VP64 and MS2-p65-HSF1 fusion proteinsDepositorInsertp300core-dCas9-VP64-T2A-MS2-p65-HSF1
UsePiggybacAvailable sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pST1374-dCas9-GCN4
Plasmid#113026PurposeExpresses dCas9-GCN4 in mammalian cellsDepositorInsertdCas9-GCN4 (GCN4 Budding Yeast, S. pyogenes)
ExpressionMammalianMutationD10A, H840A, N863APromoterCMVAvailable sinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX459V2.0-SpCas9-HF4
Plasmid#108295PurposepX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC148-pCR8-dCas9VP96
Plasmid#48220PurposedCas9VP96 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP96 activation domain
UseCRISPR and Gateway CloningTagsHA Tag and VP96MutationD10A;H840AAvailable sinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA_HPRT1_ex3-CBh-3xFLAG-NLS-Cas9-NLS-T2A-mCherry
Plasmid#250373PurposeVector expressing sgRNA against human HPRT1 exon 3 under U6 promoter and 3xFLAG-NLS-Cas9-NLS-T2A-mCherry under CBh promoter.DepositorAvailable sinceJuly 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZFAND3-guide4
Plasmid#125459PurposeCRISPR-mediated repression of ZFAND3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZFAND3-guide3
Plasmid#125458PurposeCRISPR-mediated repression of ZFAND3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only