We narrowed to 18,351 results for: multi
-
Plasmid#206262PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Empty backbone.DepositorTypeEmpty backboneUseMultimate/gateway entr 3Available sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMMK ENTR 4
Plasmid#206263PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Empty backbone.DepositorTypeEmpty backboneUseMultimate/gateway entr 4Available sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorPublicationInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBER
Plasmid#62662PurposeDonor vector for tdTomato knock-in via landing padDepositorInsertstdTomato
hygromycin
UseCre/LoxAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag17-iCAM-1
Plasmid#205204PurposeThis vector encodes of the synCAM (iCAM1) and GFP nanobody LAG17DepositorInsertsynCAM iCAM1 and Lag17 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag16-DLL1
Plasmid#205201PurposeThis vector encodes of the synCAM (DLL-1) and GFP nanobody LAG16DepositorInsertsynCAM DLL1 and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR- flag-Lag16-MUC4
Plasmid#205198PurposeThis vector encodes of the synCAM (MUC4) and GFP nanobody LAG16DepositorInsertsynCAM MUC4 and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_P2
Plasmid#194344PurposesgRNA position entry clone 2DepositorInsertsgRNA expression cassettes and LacZ
ExpressionPlantPromoterAth U6 promoterAvailable sinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_P1
Plasmid#194343PurposesgRNA position entry clone 1DepositorInsertsgRNA expression cassettes and LacZ
ExpressionPlantPromoterAth U6 promoterAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_P3
Plasmid#194345PurposesgRNA position entry clone 3DepositorInsertsgRNA expression cassettes and LacZ
ExpressionPlantPromoterAth U6 promoterAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_P4
Plasmid#194346PurposesgRNA position entry clone 4DepositorInsertsgRNA expression cassettes and LacZ
ExpressionPlantPromoterAth U6 promoterAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_P5
Plasmid#194347PurposesgRNA position entry clone 5DepositorInsertsgRNA expression cassettes and LacZ
ExpressionPlantPromoterAth U6 promoterAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_P6
Plasmid#194348PurposesgRNA position entry clone 6DepositorInsertsgRNA expression cassettes and LacZ
ExpressionPlantPromoterAth U6 promoterAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_P7
Plasmid#194349PurposesgRNA position entry clone 7DepositorInsertsgRNA expression cassettes and LacZ
ExpressionPlantPromoterAth U6 promoterAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No3
Plasmid#194898PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-3 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.3
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No9
Plasmid#194903PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-9 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.9
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag16-fibcon-iCAM1
Plasmid#205212PurposeThis vector encodes of the synCAM (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
phCMV-IE1
Plasmid#118048PurposeGBPart - Cytomegalovirus enhancer and promoter for constitutive high level expression in mammalian cellsDepositorInsertCytomegalovirus enhancer and promoter
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable sinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
FRT2-H2B-EGFP-V5-2A (IG157)
Plasmid#99623PurposeTo clone gene of interest downstream of FRT2-H2B-EGFP-V5-2A cassetteDepositorInsertH2B-EGFP-V5
TagsT2AExpressionMammalianAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only