We narrowed to 27,674 results for: GFP
-
Plasmid#211734PurposeExpresses GFP tagged VDAC1 in mammalian cells. GFP is attached to the C-terminus of VDAC1 with a flexible linker.DepositorAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pFA6a-link-yoEGFP-Kan
Plasmid#44900PurposeYeast tagging vector to create gene fusion with yeast optimized EGFP with Kan selectionDepositorInsertyoEGFP
ExpressionYeastAvailable SinceMay 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eGFP-Cre
Plasmid#120219PurposeExpresses cre under the control of CamKIIa promotorDepositorInsertcre
UseAAV and Cre/LoxTagsEGFPAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUbC-nls-ha-stdMCP-stdGFP
Plasmid#98916Purposesynonymized tandem dimer MCP fused to synonymized tandem dimer GFPDepositorInsertstdMCP-stdGFP
UseLentiviralTagsGFPPromoterUbCAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABE.puro/TO/Flag/tGFP-HuR.wt
Plasmid#110349PurposeDoxycycline inducible mammalian retroviral expression of HuR (wild type) with FLAG and turboGFP tagsDepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsFLAG and tGFPExpressionMammalianPromotergagAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shSRGAP2B/C#2-hsynapsin-EGFP
Plasmid#220797PurposeshRNA plasmid against human SRGAP2B/C genes (#2) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-GFP1-9 T2A mCherry
Plasmid#124430PurposeExpresses GFP1-9 and T2A mCherry in mammalian cellsDepositorInsertGFP1-9 T2A mCherry
ExpressionMammalianAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-AID-BubR1
Plasmid#47330Purposefor plasmid integration using the Flp-In system. AID at N-terminalDepositorInsertBUB1 mitotic checkpoint serine/threonine kinase B (BUB1B Human)
TagsAID and GFPExpressionMammalianMutationsiRNA resistantAvailable SinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-ColX
Plasmid#222305PurposeSynchronize the trafficking of CollagenX from the ER.DepositorInsertStreptavidin-KDEL and CollagenX fused to SBP-EGFP (COL10A1 Human)
ExpressionMammalianMutationsignal peptide of COL10A1 removedPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CUG-IRES-mCherry
Plasmid#222110PurposeStart codon reporter with mutated start codonDepositorInsertGFP-IRES-mCherry
UseLentiviralMutationCUG start codonAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IPU-GFP-NEK9W967A
Plasmid#168271PurposeExpresses LIR (LC3-interacting region) mutant NEK9DepositorAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shSRGAP2B/C#1-hsynapsin-EGFP
Plasmid#220796PurposeshRNA plasmid against human SRGAP2B/C genes (#1) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP221-AAV-RSV-GFP-pA
Plasmid#62919PurposeAAV vector backbone designed to express GFP from a RSV promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoterRous Sarcoma Virus(RSV)Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACUH-GFP11x7-mCherry-α-tubulin
Plasmid#70218PurposeExpresses GFP11x7-mCherry-α-tubulin in insect cells. 5 a. a. linker lengths.DepositorInsertGFP11x7-mCherry-α-tubulin
TagsGFP11x7 and mCherryExpressionInsectAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-25xUPRE-minP-EGFP
Plasmid#159668PurposeEGFP reporter plasmid containing 25 tandem repeats of the the unfolded protein response element (UPRE)DepositorInsert25xUPRE-minP-EGFP
UseLentiviralExpressionMammalianAvailable SinceMarch 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT3-Neo-EF1a-GFP
Plasmid#69134PurposeSleeping Beaquty (SB) vector encoding G418 resistance and GFP from two separate promotersDepositorTypeEmpty backboneUseSleeping beauty transposonExpressionMammalianPromoterU3MSCVAvailable SinceJan. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAG-Otx2-IRES-GFPd2
Plasmid#73996PurposePlasmid expressing Otx2(isoform b)-IRES-GFPd2DepositorAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only