We narrowed to 28,354 results for: cmv promoter
-
Plasmid#174091PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a C-terminal bi-partite NLS, 3x flag tag, and P2A-mScarletDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianPromoterpCMV and T7Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-eGFP
Plasmid#247941PurposeAAV transfer plasmid encoding enhanced Green Fluoresence Protein control of the CMVie enhanced synapsin1 promoterDepositorInserteGFP
UseAAVPromoterCMVenh synapsinAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-minCMV)-mGL-BGH_pKG3654
Plasmid#246333Purpose203-bp DIAL Reporter Plasmid with minCMV expressing mGreenLantern in the presence of ZFa and editable by Cre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-scFv-GCN4-sfGFP-tdP2A-Frankenbody-FLAG-mScarlet3-IRESv4-HaloTag-tdMCP
Plasmid#241141PurposeExpresses Anti-GCN4 scFv-sfGFP, anti-FLAG frankenbody-mEGFP, and HaloTag-tdMCP to track mature and nascent SunTag and FLAG-tagged proteins and MS2-tagged mRNADepositorInsertsAnti-GCN4 scFv
anti-FLAG frankenbody
tdMCP
TagsHaloTag, mEGFP, and sfGFPExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Click editor utilizing mSA for template recruitment - pCMV-T7-mSA-nCas9-EcKlenow (JO1391)
Plasmid#217802PurposeVariant CE1 construct with mSA for template recruitment, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; mSA-EcKlenow fusion - pCMV-T7-mSA-EcKlenow (JO1401)
Plasmid#217806PurposeUnfused click editor construct expressing mSA-EcKlenow, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing Cdc13 for template recruitment - pCMV-T7-Cdc13-nCas9-EcKlenow (JO1293)
Plasmid#217796PurposeVariant CE1 construct with Cdc13 telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-D842V_EGFP-PEST_reporter
Plasmid#172598PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-D842V mutant signaling.DepositorInsertmyc-PDGFRA-D842V (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-D842VPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV5 N-MYC hHIF1a
Plasmid#246215PurposeUsed for transfection of cells for expression N-MYC hHIF1aDepositorAvailable SinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-CMV-V5-ZSWIM8
Plasmid#254997PurposeUsed to overexpress V5 tagged human ZSWIM8DepositorAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
CMV5 N-HA hHIF1a P402A
Plasmid#246216PurposeUsed for transfection of cells for expression N-HA hHIF1a P402ADepositorAvailable SinceApril 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRZ212:CMVp-GAD-pA
Plasmid#251312PurposeExpression of GAD under CMVp promoter for use in synthetic gene circuitsDepositorInsertGAD
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform2_untagged-Puro
Plasmid#192002PurposeLentiviral vector to generate LYSET(TMEM251)-isoform2 stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro
Plasmid#192004PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 I142V mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMVTRE3G_LYSET-Isoform1_R45W-Puro
Plasmid#192003PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV Ub Lex HA (P#1707)
Plasmid#14592DepositorInsertLexA
TagsHA and UbiquitinExpressionMammalianAvailable SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-SARS-CoV-2-S-Bel-P5_5-7-IRES-mNeonGreen-NES/PKI-P2A-Blasticidin
Plasmid#237480PurposeEncodes full-length SARS-CoV-2 Spike protein (Belgium/GHB-03021 isolate), featuring the E484D substitution, which likely emerged during passaging and enhances TMEM106B binding.DepositorInsertSARS-CoV-2 Spike protein (Belgium/GHB-03021 isolate)
UseLentiviralTagsIRES-mNeonGreen-NES/PKI and P2A-BlasticidinExpressionMammalianMutationS484D + S813I + deleted amino acids 68-76 + 676-6…PromoterCMVAvailable SinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW375 (PB) (ZNF35/IKZF1tar-6bp spacers)x4-H2B-BFP insul CMV-TO-GFP-deimlink-NZF
Plasmid#236177PurposePiggyBac-integrated plasmid containing hygromycin resistance gene, ZNF35/IKZF1-driven BFP, and GFP-NZF dummy transcription factorDepositorInsertsTagsmTagBFP2ExpressionMammalianPromoterCMV and four ZNF35/IKZF1 sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only