We narrowed to 18,849 results for: multi
-
Plasmid#242604PurposeA CAGGS driven expression vector containing V5 tagged mScarlet3-H. H2B for nuclear labelingDepositorInsertH2B-mScarlet3-H
ExpressionMammalianPromoterCAGGSAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-HyperdLbCas12a-tagBFP-NLS-3xFlag
Plasmid#236385PurposeOverexpression of HyperdLbCas12a in human cellsDepositorInsertHyperdLbCas12a
UseCRISPR and LentiviralMutationD156R, D235R, E292R, D350RAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-HyperdLbCas12a-EGFP-NLS-3xFlag
Plasmid#236367PurposeOverexpression of HyperdLbCas12a in human cellsDepositorInsertHyperdLbCas12a
UseCRISPR and LentiviralMutationD156R, D235R, E292R, D350RAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dLbCas12aRVRR-EGFP-NLS-3xFlag
Plasmid#236365PurposeOverexpression of dLbCas12aRVRR in human cellsDepositorInsertdLbCas12aRVRR
UseCRISPR and LentiviralMutationG532R, K538V, Y542R, K595RAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-N-RAM-CytoTape-V5
Plasmid#239425PurposeCytoTape signal monomer for recording Npas4 protein activityDepositorInsertCytoTape-V5
UseAAVTagsV5-dMBPExpressionMammalianPromoterN-RAM promoterAvailable SinceNov. 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBBR1-EcTyrRS(VSMA,D165G)
Plasmid#231132PurposeExpresses mutant E. coli TyrRS from a derepressed lac promoter for proteome-wide incorporation of tyrosine in E. coli/K. pneumoniae.DepositorInsertE. coli tyrosyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationY37V, D165G, D182S, P183M, L186A, D265RAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-DRE-nls (JDW 31)
Plasmid#242561PurposeGateway middle entry clone containing Dre recombinaseDepositorInsertcodon optimized DRE-nls
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E-mCherry-SV40-pA (JDW 1417)
Plasmid#242570PurposeGateway 3' entry clone containing mCherry followed by an SV40 polyA.DepositorInsertmCherry stop SV40 pA
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G12-AkaLuc-P2A-Proinsulin
Plasmid#241776PurposeTested on HeLa for bioluminescence, and used for production of AAV G12-Akaluc-P2A-Proinsulin for mice.DepositorInsertAkaLuc-P2A-Proinsulin
UseAAVPromoter12xUAS with TATA-box minimal promoterAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-Lifeact-mRuby2-3xMyc (JDW 1246)
Plasmid#242554PurposeGateway middle entry clone containing Lifeact-mRuby2-3xMyc; Red F-actin reporterDepositorInsertmRuby2
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mScarlet-3H (JDW 1513)
Plasmid#242551PurposeGateway middle entry clone containing H2B-mScarlet-3H; Nuclear red fluorescent reporterDepositorInsertmScarlet3-H
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-48xGPBP1 array
Plasmid#236383PurposeExpression of array of 48 crRNAs targeting GPBP1DepositorInsert48xGPBP1 crRNA array (GPBP1 Human)
UseCRISPR and LentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only